Mutagenetix > Incidental Mutations

Incidental Mutation 'R6825:Kmt2a'

534112

Institutional Source

Beutler Lab

Gene Symbol

Kmt2a

Ensembl Gene

ENSMUSG00000002028

Gene Name

lysine (K)-specific methyltransferase 2A

Synonyms

Mll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6825 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44803355-44881296 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 44818407 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689]

Predicted Effect

unknown
Transcript: ENSMUST00000002095
AA Change: R3535W

SMART Domains

Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: R3535W

Domain	Start	End	E-Value	Type
low complexity region	14	29	N/A	INTRINSIC
low complexity region	41	102	N/A	INTRINSIC
PDB:3U88\|N	103	151	6e-15	PDB
AT_hook	171	183	2.12e2	SMART
AT_hook	217	229	4.68e1	SMART
AT_hook	298	310	2.8e0	SMART
coiled coil region	366	394	N/A	INTRINSIC
low complexity region	450	489	N/A	INTRINSIC
low complexity region	524	535	N/A	INTRINSIC
low complexity region	544	574	N/A	INTRINSIC
low complexity region	589	601	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	717	732	N/A	INTRINSIC
low complexity region	760	790	N/A	INTRINSIC
low complexity region	866	892	N/A	INTRINSIC
low complexity region	989	1005	N/A	INTRINSIC
Pfam:zf-CXXC	1144	1191	1.1e-15	PFAM
low complexity region	1204	1233	N/A	INTRINSIC
low complexity region	1236	1283	N/A	INTRINSIC
low complexity region	1295	1316	N/A	INTRINSIC
low complexity region	1323	1345	N/A	INTRINSIC
low complexity region	1353	1366	N/A	INTRINSIC
PHD	1432	1479	5.57e-3	SMART
PHD	1480	1530	1.17e-10	SMART
PHD	1567	1624	7.94e-8	SMART
BROMO	1632	1766	2.24e-10	SMART
low complexity region	1816	1850	N/A	INTRINSIC
PHD	1931	1977	1.74e-4	SMART
low complexity region	1990	2001	N/A	INTRINSIC
FYRN	2029	2072	2.33e-20	SMART
low complexity region	2180	2194	N/A	INTRINSIC
low complexity region	2215	2227	N/A	INTRINSIC
low complexity region	2607	2618	N/A	INTRINSIC
low complexity region	2789	2800	N/A	INTRINSIC
low complexity region	2824	2833	N/A	INTRINSIC
low complexity region	2856	2878	N/A	INTRINSIC
low complexity region	2902	2909	N/A	INTRINSIC
low complexity region	3115	3141	N/A	INTRINSIC
low complexity region	3164	3175	N/A	INTRINSIC
low complexity region	3228	3239	N/A	INTRINSIC
low complexity region	3299	3312	N/A	INTRINSIC
low complexity region	3342	3351	N/A	INTRINSIC
low complexity region	3405	3419	N/A	INTRINSIC
low complexity region	3498	3526	N/A	INTRINSIC
low complexity region	3620	3633	N/A	INTRINSIC
FYRC	3662	3747	8.54e-37	SMART
SET	3823	3945	6.09e-45	SMART
PostSET	3947	3963	1.65e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000114689
AA Change: R3538W

SMART Domains

Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: R3538W

Domain	Start	End	E-Value	Type
low complexity region	14	29	N/A	INTRINSIC
low complexity region	41	102	N/A	INTRINSIC
PDB:3U88\|N	103	151	6e-15	PDB
AT_hook	171	183	2.12e2	SMART
AT_hook	217	229	4.68e1	SMART
AT_hook	298	310	2.8e0	SMART
coiled coil region	366	394	N/A	INTRINSIC
low complexity region	450	489	N/A	INTRINSIC
low complexity region	524	535	N/A	INTRINSIC
low complexity region	544	574	N/A	INTRINSIC
low complexity region	589	601	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	717	732	N/A	INTRINSIC
low complexity region	760	790	N/A	INTRINSIC
low complexity region	866	892	N/A	INTRINSIC
low complexity region	989	1005	N/A	INTRINSIC
Pfam:zf-CXXC	1144	1191	1.1e-15	PFAM
low complexity region	1204	1233	N/A	INTRINSIC
low complexity region	1236	1283	N/A	INTRINSIC
low complexity region	1295	1316	N/A	INTRINSIC
low complexity region	1323	1345	N/A	INTRINSIC
low complexity region	1353	1366	N/A	INTRINSIC
PHD	1432	1479	5.57e-3	SMART
PHD	1480	1530	1.17e-10	SMART
PHD	1567	1627	9.12e-8	SMART
BROMO	1635	1769	2.24e-10	SMART
low complexity region	1819	1853	N/A	INTRINSIC
PHD	1934	1980	1.74e-4	SMART
low complexity region	1993	2004	N/A	INTRINSIC
FYRN	2032	2075	2.33e-20	SMART
low complexity region	2183	2197	N/A	INTRINSIC
low complexity region	2218	2230	N/A	INTRINSIC
low complexity region	2610	2621	N/A	INTRINSIC
low complexity region	2792	2803	N/A	INTRINSIC
low complexity region	2827	2836	N/A	INTRINSIC
low complexity region	2859	2881	N/A	INTRINSIC
low complexity region	2905	2912	N/A	INTRINSIC
low complexity region	3118	3144	N/A	INTRINSIC
low complexity region	3167	3178	N/A	INTRINSIC
low complexity region	3231	3242	N/A	INTRINSIC
low complexity region	3302	3315	N/A	INTRINSIC
low complexity region	3345	3354	N/A	INTRINSIC
low complexity region	3408	3422	N/A	INTRINSIC
low complexity region	3501	3529	N/A	INTRINSIC
low complexity region	3623	3636	N/A	INTRINSIC
FYRC	3665	3750	8.54e-37	SMART
SET	3826	3948	6.09e-45	SMART
PostSET	3950	3966	1.65e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000138119
AA Change: R570W

Predicted Effect

probably benign
Transcript: ENSMUST00000152241

Meta Mutation Damage Score

0.0871

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	A	T	12: 72,907,880	S206T	probably benign	Het
Aasdh	A	T	5: 76,888,849		probably null	Het
Adam10	G	T	9: 70,761,602	C400F	probably damaging	Het
Ankle2	A	T	5: 110,250,769	R561S	probably null	Het
Arhgef5	C	T	6: 43,274,961	T882I	probably damaging	Het
Arpc1a	A	T	5: 145,096,126	K82*	probably null	Het
Card11	C	A	5: 140,878,082	R967L	probably benign	Het
Ccdc82	G	T	9: 13,251,976		probably benign	Het
Cebpz	T	C	17: 78,919,963	D1026G	probably damaging	Het
Cit	A	T	5: 115,981,774	Q1321L	probably damaging	Het
Clcn2	C	A	16: 20,709,658		probably benign	Het
Csf3	G	C	11: 98,702,447	G130A	probably damaging	Het
Cul2	T	A	18: 3,434,946	S737T	probably damaging	Het
Cyp1a2	G	A	9: 57,677,260	H504Y	probably benign	Het
Cyp3a44	G	A	5: 145,779,586	P398L	probably damaging	Het
Dnah8	T	C	17: 30,741,173	I2206T	probably damaging	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Epb41l5	A	T	1: 119,620,201	D157E	possibly damaging	Het
Ercc8	T	C	13: 108,158,809	S6P	probably damaging	Het
Faxc	T	C	4: 21,931,672	S37P	probably benign	Het
Fbxl19	T	A	7: 127,750,015	I119K	probably damaging	Het
Frmd4b	A	G	6: 97,325,476	V195A	possibly damaging	Het
Fut9	A	T	4: 25,619,925	S296R	probably benign	Het
Gas6	T	C	8: 13,483,674	N112D	probably benign	Het
H2-Q1	T	C	17: 35,321,052	L99P	probably damaging	Het
Helq	A	T	5: 100,792,695	I346N	probably damaging	Het
Hepacam	A	G	9: 37,367,680	K2E	possibly damaging	Het
Itgae	T	C	11: 73,118,496	M502T	possibly damaging	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Macf1	A	T	4: 123,383,222		probably null	Het
Mgat4a	T	A	1: 37,464,434	K220*	probably null	Het
Olfr1199	T	C	2: 88,755,911	I255V	possibly damaging	Het
Olfr1469	G	A	19: 13,411,150	V194I	probably benign	Het
Olfr224	T	C	11: 58,566,650	R232G	possibly damaging	Het
Pex5	A	T	6: 124,414,381	M18K	probably damaging	Het
Phlda3	T	C	1: 135,766,824	*126Q	probably null	Het
Plxna1	G	T	6: 89,320,615	D1862E	probably benign	Het
Pold4	A	T	19: 4,232,110	I7F	possibly damaging	Het
Prkaa1	A	T	15: 5,143,950	I19F	possibly damaging	Het
Prl7d1	T	G	13: 27,710,142	E148A	probably benign	Het
Prr14l	A	T	5: 32,828,548	V1201E	possibly damaging	Het
Rab3gap1	T	C	1: 127,930,421	C510R	probably damaging	Het
Rhbdf1	C	T	11: 32,209,970	R802H	probably damaging	Het
Rpl18a	A	C	8: 70,896,192	F47V	probably damaging	Het
Sema5b	C	A	16: 35,628,007		probably null	Het
Sspo	G	A	6: 48,465,525	G1985R	probably benign	Het
Tcaf2	C	T	6: 42,629,518	A501T	probably benign	Het
Tcerg1	A	G	18: 42,548,477	D563G	probably damaging	Het
Tdh	G	A	14: 63,495,832	T155M	probably damaging	Het
Tenm2	T	C	11: 36,046,884	N1654S	probably benign	Het
Tlr5	A	T	1: 182,973,044		probably benign	Het
Tns1	G	T	1: 74,002,323	C136*	probably null	Het
Tomm5	A	T	4: 45,106,443		probably null	Het
Trio	A	T	15: 27,889,308	F512I	probably damaging	Het
Ttll5	A	T	12: 85,883,328		probably null	Het
Upp1	T	A	11: 9,131,707	H81Q	probably benign	Het
Usp42	A	G	5: 143,727,807	S71P	probably damaging	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Zap70	A	G	1: 36,778,390	Y238C	probably damaging	Het
Zfp398	A	G	6: 47,866,331	D307G	probably damaging	Het

Other mutations in Kmt2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Kmt2a	APN	9	44807934	unclassified	probably benign
IGL00667:Kmt2a	APN	9	44824386	utr 3 prime	probably benign
IGL00828:Kmt2a	APN	9	44820776	unclassified	probably benign
IGL01080:Kmt2a	APN	9	44809092	missense	unknown
IGL01131:Kmt2a	APN	9	44821170	unclassified	probably benign
IGL01294:Kmt2a	APN	9	44820297	unclassified	probably benign
IGL01432:Kmt2a	APN	9	44809096	missense	unknown
IGL01646:Kmt2a	APN	9	44825484	utr 3 prime	probably benign
IGL01777:Kmt2a	APN	9	44849005	missense	probably damaging	0.99
IGL01944:Kmt2a	APN	9	44849767	missense	probably damaging	1.00
IGL02125:Kmt2a	APN	9	44848686	missense	probably damaging	1.00
IGL02207:Kmt2a	APN	9	44847682	missense	probably damaging	0.98
IGL02424:Kmt2a	APN	9	44824635	utr 3 prime	probably benign
IGL02499:Kmt2a	APN	9	44830509	splice site	probably benign
IGL02574:Kmt2a	APN	9	44830513	splice site	probably benign
IGL02711:Kmt2a	APN	9	44824523	splice site	probably benign
IGL02828:Kmt2a	APN	9	44821947	unclassified	probably benign
IGL03012:Kmt2a	APN	9	44810966	unclassified	probably benign
IGL03242:Kmt2a	APN	9	44848392	missense	probably damaging	0.99
IGL03294:Kmt2a	APN	9	44820565	unclassified	probably benign
IGL03326:Kmt2a	APN	9	44818747	nonsense	probably null
Chromas	UTSW	9	44820342	unclassified	probably benign
Heteros	UTSW	9	44828811	nonsense	probably null
Pyknos	UTSW	9	44826828	utr 3 prime	probably benign
Skies	UTSW	9	44829261	utr 3 prime	probably benign
spacious	UTSW	9	44847645	missense	probably benign	0.03
PIT4402001:Kmt2a	UTSW	9	44841062	missense	unknown
R0076:Kmt2a	UTSW	9	44830059	utr 3 prime	probably benign
R0076:Kmt2a	UTSW	9	44830059	utr 3 prime	probably benign
R0180:Kmt2a	UTSW	9	44826851	utr 3 prime	probably benign
R0363:Kmt2a	UTSW	9	44809713	critical splice donor site	probably null
R0411:Kmt2a	UTSW	9	44819964	unclassified	probably benign
R0555:Kmt2a	UTSW	9	44847571	missense	probably damaging	1.00
R0587:Kmt2a	UTSW	9	44847534	missense	probably damaging	0.99
R0865:Kmt2a	UTSW	9	44818770	unclassified	probably benign
R0988:Kmt2a	UTSW	9	44848549	missense	probably benign	0.03
R1006:Kmt2a	UTSW	9	44847696	missense	probably damaging	0.99
R1108:Kmt2a	UTSW	9	44849062	missense	probably damaging	1.00
R1292:Kmt2a	UTSW	9	44814694	utr 3 prime	probably benign
R1322:Kmt2a	UTSW	9	44821121	unclassified	probably benign
R1476:Kmt2a	UTSW	9	44824635	utr 3 prime	probably benign
R1485:Kmt2a	UTSW	9	44826928	utr 3 prime	probably benign
R1487:Kmt2a	UTSW	9	44833990	utr 3 prime	probably benign
R1493:Kmt2a	UTSW	9	44846905	missense	probably damaging	1.00
R1499:Kmt2a	UTSW	9	44848266	missense	probably benign	0.36
R1507:Kmt2a	UTSW	9	44818403	unclassified	probably benign
R1603:Kmt2a	UTSW	9	44841561	unclassified	probably null
R1635:Kmt2a	UTSW	9	44824369	utr 3 prime	probably benign
R1662:Kmt2a	UTSW	9	44836670	utr 3 prime	probably benign
R1711:Kmt2a	UTSW	9	44841621	missense	unknown
R1785:Kmt2a	UTSW	9	44819675	unclassified	probably benign
R1786:Kmt2a	UTSW	9	44819675	unclassified	probably benign
R1919:Kmt2a	UTSW	9	44820345	unclassified	probably benign
R1964:Kmt2a	UTSW	9	44820644	missense	probably benign	0.23
R1965:Kmt2a	UTSW	9	44821460	unclassified	probably benign
R2029:Kmt2a	UTSW	9	44818450	missense	probably benign	0.23
R2054:Kmt2a	UTSW	9	44823374	utr 3 prime	probably benign
R2259:Kmt2a	UTSW	9	44881142	unclassified	probably benign
R2382:Kmt2a	UTSW	9	44820910	unclassified	probably benign
R2483:Kmt2a	UTSW	9	44848966	missense	probably damaging	0.99
R3033:Kmt2a	UTSW	9	44821863	unclassified	probably benign
R3423:Kmt2a	UTSW	9	44820097	unclassified	probably benign
R3428:Kmt2a	UTSW	9	44848119	missense	probably benign	0.06
R3605:Kmt2a	UTSW	9	44849196	missense	probably damaging	1.00
R3607:Kmt2a	UTSW	9	44849196	missense	probably damaging	1.00
R3611:Kmt2a	UTSW	9	44822466	unclassified	probably benign
R3623:Kmt2a	UTSW	9	44848966	missense	probably damaging	0.99
R3745:Kmt2a	UTSW	9	44831340	utr 3 prime	probably benign
R3806:Kmt2a	UTSW	9	44820356	unclassified	probably benign
R3841:Kmt2a	UTSW	9	44831291	utr 3 prime	probably benign
R3855:Kmt2a	UTSW	9	44830499	utr 3 prime	probably benign
R4027:Kmt2a	UTSW	9	44836693	utr 3 prime	probably benign
R4124:Kmt2a	UTSW	9	44819796	unclassified	probably benign
R4177:Kmt2a	UTSW	9	44820983	unclassified	probably benign
R4296:Kmt2a	UTSW	9	44821175	unclassified	probably benign
R4414:Kmt2a	UTSW	9	44809780	unclassified	probably benign
R4461:Kmt2a	UTSW	9	44848966	missense	probably damaging	0.99
R4668:Kmt2a	UTSW	9	44824572	utr 3 prime	probably benign
R4761:Kmt2a	UTSW	9	44849124	missense	probably damaging	1.00
R4812:Kmt2a	UTSW	9	44831354	utr 3 prime	probably benign
R4815:Kmt2a	UTSW	9	44821256	unclassified	probably benign
R4817:Kmt2a	UTSW	9	44821466	unclassified	probably benign
R4888:Kmt2a	UTSW	9	44821680	unclassified	probably benign
R4958:Kmt2a	UTSW	9	44848467	missense	probably damaging	1.00
R5055:Kmt2a	UTSW	9	44818352	unclassified	probably benign
R5065:Kmt2a	UTSW	9	44842700	unclassified	probably benign
R5185:Kmt2a	UTSW	9	44820246	unclassified	probably benign
R5358:Kmt2a	UTSW	9	44819274	unclassified	probably benign
R5411:Kmt2a	UTSW	9	44848485	missense	probably damaging	1.00
R5420:Kmt2a	UTSW	9	44848336	missense	probably damaging	1.00
R5483:Kmt2a	UTSW	9	44824624	utr 3 prime	probably benign
R5487:Kmt2a	UTSW	9	44821975	unclassified	probably benign
R5488:Kmt2a	UTSW	9	44841038	utr 3 prime	probably benign
R5489:Kmt2a	UTSW	9	44841038	utr 3 prime	probably benign
R5538:Kmt2a	UTSW	9	44820342	unclassified	probably benign
R5576:Kmt2a	UTSW	9	44842634	missense	possibly damaging	0.94
R5631:Kmt2a	UTSW	9	44820688	unclassified	probably benign
R5781:Kmt2a	UTSW	9	44847842	nonsense	probably null
R5789:Kmt2a	UTSW	9	44819904	unclassified	probably benign
R5932:Kmt2a	UTSW	9	44820647	unclassified	probably benign
R6027:Kmt2a	UTSW	9	44819290	unclassified	probably benign
R6191:Kmt2a	UTSW	9	44826828	utr 3 prime	probably benign
R6239:Kmt2a	UTSW	9	44819796	unclassified	probably benign
R6291:Kmt2a	UTSW	9	44832874	utr 3 prime	probably benign
R6344:Kmt2a	UTSW	9	44821859	unclassified	probably benign
R6611:Kmt2a	UTSW	9	44849272	missense	probably damaging	0.98
R6641:Kmt2a	UTSW	9	44819835	unclassified	probably benign
R6651:Kmt2a	UTSW	9	44828811	nonsense	probably null
R6853:Kmt2a	UTSW	9	44818407	unclassified	probably benign
R6897:Kmt2a	UTSW	9	44847645	missense	probably benign	0.03
R6930:Kmt2a	UTSW	9	44842665	unclassified	probably benign
R6932:Kmt2a	UTSW	9	44829261	utr 3 prime	probably benign
R6957:Kmt2a	UTSW	9	44820022	unclassified	probably benign
R7170:Kmt2a	UTSW	9	44810721	missense	unknown
R7202:Kmt2a	UTSW	9	44847715	missense	probably benign	0.03
R7481:Kmt2a	UTSW	9	44809071	missense	unknown
R7538:Kmt2a	UTSW	9	44847744	missense	probably damaging	0.99
R7597:Kmt2a	UTSW	9	44831353	missense	unknown
R7741:Kmt2a	UTSW	9	44808062	missense	unknown
R7767:Kmt2a	UTSW	9	44818998	missense	unknown
R7768:Kmt2a	UTSW	9	44820603	missense	unknown
X0021:Kmt2a	UTSW	9	44831235	utr 3 prime	probably benign
X0025:Kmt2a	UTSW	9	44825392	nonsense	probably null
X0026:Kmt2a	UTSW	9	44820906	unclassified	probably benign
X0027:Kmt2a	UTSW	9	44880896	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GTGACAAGAATTCTCGAGCACC -3'
(R):5'- AACCGGTACCCTGACTTCAC -3'

Sequencing Primer
(F):5'- ACTGCGTGACACCCAGAG -3'
(R):5'- TACCCTGACTTCACAGCGG -3'

Posted On

2018-09-12