Incidental Mutation 'R6826:Slc24a5'
ID534141
Institutional Source Beutler Lab
Gene Symbol Slc24a5
Ensembl Gene ENSMUSG00000035183
Gene Namesolute carrier family 24, member 5
SynonymsOca6, NCX5, F630045L20Rik, NCKX5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125068124-125088677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125068858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 70 (V70I)
Ref Sequence ENSEMBL: ENSMUSP00000063887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070353]
Predicted Effect probably benign
Transcript: ENSMUST00000070353
AA Change: V70I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000063887
Gene: ENSMUSG00000035183
AA Change: V70I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Na_Ca_ex 72 216 1.1e-24 PFAM
low complexity region 274 290 N/A INTRINSIC
low complexity region 311 324 N/A INTRINSIC
Pfam:Na_Ca_ex 334 485 7.6e-31 PFAM
low complexity region 488 500 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypopigmentation and ocular albinism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Slc24a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Slc24a5 APN 2 125080889 missense probably damaging 1.00
IGL01307:Slc24a5 APN 2 125080880 missense probably damaging 1.00
IGL01926:Slc24a5 APN 2 125068903 missense probably benign 0.01
IGL02090:Slc24a5 APN 2 125068298 missense probably benign 0.25
IGL02313:Slc24a5 APN 2 125085647 unclassified probably benign
IGL02328:Slc24a5 APN 2 125080639 missense probably damaging 1.00
IGL02743:Slc24a5 APN 2 125088234 missense probably damaging 1.00
IGL02969:Slc24a5 APN 2 125083227 missense probably damaging 1.00
IGL03212:Slc24a5 APN 2 125080830 missense probably damaging 1.00
IGL03258:Slc24a5 APN 2 125080705 critical splice donor site probably null
R0344:Slc24a5 UTSW 2 125085701 missense probably benign 0.03
R0811:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R0812:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R1018:Slc24a5 UTSW 2 125068907 missense probably damaging 1.00
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1753:Slc24a5 UTSW 2 125083195 missense possibly damaging 0.53
R2147:Slc24a5 UTSW 2 125087441 missense probably damaging 1.00
R4934:Slc24a5 UTSW 2 125088020 missense probably damaging 1.00
R4964:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R4966:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R5225:Slc24a5 UTSW 2 125085819 missense probably damaging 0.99
R5275:Slc24a5 UTSW 2 125085861 missense probably benign 0.09
R5438:Slc24a5 UTSW 2 125068865 missense probably damaging 1.00
R5866:Slc24a5 UTSW 2 125085671 missense probably damaging 1.00
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6114:Slc24a5 UTSW 2 125083092 missense probably benign 0.01
R6211:Slc24a5 UTSW 2 125088251 missense probably benign 0.23
R6516:Slc24a5 UTSW 2 125088107 missense probably benign 0.01
R6675:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6677:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R7100:Slc24a5 UTSW 2 125080671 missense probably damaging 1.00
R7122:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R7381:Slc24a5 UTSW 2 125068949 missense probably benign 0.29
R7398:Slc24a5 UTSW 2 125085774 nonsense probably null
R7401:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R8219:Slc24a5 UTSW 2 125085655 critical splice acceptor site probably null
X0067:Slc24a5 UTSW 2 125087503 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCCCAAATACCCCAGTTTAGG -3'
(R):5'- AAAACGTGCTTCTGCCTGG -3'

Sequencing Primer
(F):5'- CAAATACCCCAGTTTAGGCTTTGTGG -3'
(R):5'- ACAGACATGGGTGCTCTGC -3'
Posted On2018-09-12