Incidental Mutation 'R6826:Snx16'
ID534145
Institutional Source Beutler Lab
Gene Symbol Snx16
Ensembl Gene ENSMUSG00000027534
Gene Namesorting nexin 16
Synonyms4930522N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location10417817-10440102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10438088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 33 (V33D)
Ref Sequence ENSEMBL: ENSMUSP00000141230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029047] [ENSMUST00000099223] [ENSMUST00000195822]
Predicted Effect probably benign
Transcript: ENSMUST00000029047
AA Change: V33D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029047
Gene: ENSMUSG00000027534
AA Change: V33D

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099223
AA Change: V33D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000096828
Gene: ENSMUSG00000027534
AA Change: V33D

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195822
AA Change: V33D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141230
Gene: ENSMUSG00000027534
AA Change: V33D

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Blast:PX 105 134 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The protein encoded by this gene associates with late endosome membranes as is involved in tubule formation, cholesterol transport, and transport of tetraspanin CD81. The encoded protein also inhibits cell migration and tumorigenesis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Snx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Snx16 APN 3 10419159 missense probably damaging 1.00
IGL02682:Snx16 APN 3 10438175 missense probably damaging 1.00
R0539:Snx16 UTSW 3 10426218 missense probably damaging 0.98
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1771:Snx16 UTSW 3 10419161 missense probably damaging 1.00
R5262:Snx16 UTSW 3 10437832 missense probably damaging 1.00
R5693:Snx16 UTSW 3 10420258 missense probably benign 0.00
R5964:Snx16 UTSW 3 10434481 missense possibly damaging 0.92
R5969:Snx16 UTSW 3 10438157 missense possibly damaging 0.93
R7456:Snx16 UTSW 3 10435481 nonsense probably null
R7996:Snx16 UTSW 3 10435449 missense probably benign 0.11
R8095:Snx16 UTSW 3 10438184 start codon destroyed probably null 1.00
R8880:Snx16 UTSW 3 10419133 missense probably benign 0.01
Z1177:Snx16 UTSW 3 10420858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGTCTGTCTTCCCAGTTC -3'
(R):5'- GCAATGAACTGCATATTGGTTGTTC -3'

Sequencing Primer
(F):5'- AGTTCACTGCCTCAGGATGCTG -3'
(R):5'- TCTTTAAGTGTTTGGACTCAAAGG -3'
Posted On2018-09-12