Incidental Mutation 'R6826:Vmn2r1'
ID534146
Institutional Source Beutler Lab
Gene Symbol Vmn2r1
Ensembl Gene ENSMUSG00000027824
Gene Namevomeronasal 2, receptor 1
SynonymsEG56544, V2r83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64081642-64105458 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 64105146 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 809 (Y809*)
Ref Sequence ENSEMBL: ENSMUSP00000029406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029406]
Predicted Effect probably null
Transcript: ENSMUST00000029406
AA Change: Y809*
SMART Domains Protein: ENSMUSP00000029406
Gene: ENSMUSG00000027824
AA Change: Y809*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 86 504 6e-92 PFAM
Pfam:NCD3G 546 599 2.4e-17 PFAM
Pfam:7tm_3 632 866 4.1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Vmn2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn2r1 APN 3 64104968 nonsense probably null
IGL00335:Vmn2r1 APN 3 64105388 missense probably damaging 0.96
IGL01509:Vmn2r1 APN 3 64103045 missense probably benign 0.03
IGL01641:Vmn2r1 APN 3 64104503 missense probably benign 0.19
IGL01656:Vmn2r1 APN 3 64081853 missense probably damaging 0.96
IGL01927:Vmn2r1 APN 3 64081684 missense probably benign 0.01
IGL02093:Vmn2r1 APN 3 64104709 missense probably benign
IGL02146:Vmn2r1 APN 3 64104683 missense probably benign 0.39
IGL02186:Vmn2r1 APN 3 64081717 missense probably benign 0.01
IGL02320:Vmn2r1 APN 3 64081759 missense possibly damaging 0.61
IGL02423:Vmn2r1 APN 3 64090244 missense probably benign 0.00
IGL02709:Vmn2r1 APN 3 64104934 missense probably benign 0.24
R0034:Vmn2r1 UTSW 3 64090014 missense probably damaging 1.00
R0064:Vmn2r1 UTSW 3 64104788 missense possibly damaging 0.76
R0152:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0305:Vmn2r1 UTSW 3 64089666 missense probably damaging 1.00
R0314:Vmn2r1 UTSW 3 64086559 missense probably damaging 1.00
R0317:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0465:Vmn2r1 UTSW 3 64081759 missense possibly damaging 0.61
R1144:Vmn2r1 UTSW 3 64090120 missense probably damaging 1.00
R1163:Vmn2r1 UTSW 3 64086625 missense probably benign 0.03
R1448:Vmn2r1 UTSW 3 64101313 missense probably damaging 1.00
R1491:Vmn2r1 UTSW 3 64089613 missense probably damaging 1.00
R1543:Vmn2r1 UTSW 3 64089573 missense probably damaging 1.00
R1611:Vmn2r1 UTSW 3 64104537 nonsense probably null
R1676:Vmn2r1 UTSW 3 64090182 nonsense probably null
R1727:Vmn2r1 UTSW 3 64081742 missense probably benign
R1851:Vmn2r1 UTSW 3 64101505 missense probably benign 0.32
R3080:Vmn2r1 UTSW 3 64089784 missense probably damaging 1.00
R3790:Vmn2r1 UTSW 3 64086764 critical splice donor site probably null
R4111:Vmn2r1 UTSW 3 64089755 missense probably benign 0.23
R4689:Vmn2r1 UTSW 3 64104653 missense possibly damaging 0.94
R4747:Vmn2r1 UTSW 3 64081846 missense probably benign 0.00
R4970:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5033:Vmn2r1 UTSW 3 64105080 missense probably damaging 1.00
R5086:Vmn2r1 UTSW 3 64089997 missense probably benign 0.00
R5112:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5385:Vmn2r1 UTSW 3 64101398 missense possibly damaging 0.89
R5629:Vmn2r1 UTSW 3 64105117 missense possibly damaging 0.87
R5762:Vmn2r1 UTSW 3 64090053 missense probably benign 0.24
R5867:Vmn2r1 UTSW 3 64104569 missense probably benign
R5893:Vmn2r1 UTSW 3 64086553 missense probably damaging 1.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6290:Vmn2r1 UTSW 3 64105452 missense probably benign 0.02
R6443:Vmn2r1 UTSW 3 64104953 missense possibly damaging 0.78
R6464:Vmn2r1 UTSW 3 64101345 missense probably benign
R6874:Vmn2r1 UTSW 3 64104955 missense probably damaging 1.00
R6882:Vmn2r1 UTSW 3 64090108 missense possibly damaging 0.64
R6983:Vmn2r1 UTSW 3 64081697 missense probably benign
R7010:Vmn2r1 UTSW 3 64104725 missense probably benign 0.19
R7144:Vmn2r1 UTSW 3 64089941 missense probably damaging 1.00
R7341:Vmn2r1 UTSW 3 64105456 makesense probably null
R7510:Vmn2r1 UTSW 3 64086501 missense probably damaging 1.00
R7557:Vmn2r1 UTSW 3 64090054 missense probably damaging 0.99
X0065:Vmn2r1 UTSW 3 64090257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACTTGGTGTTGGAGCCTC -3'
(R):5'- TCCACCAACAGTTTCATCAGTG -3'

Sequencing Primer
(F):5'- AGCCTCCAAGGATGTTCAAG -3'
(R):5'- CTTTGGCCTCAGCAAGATAATGAAGC -3'
Posted On2018-09-12