Incidental Mutation 'R6826:Bmpr1b'
ID534149
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Namebone morphogenetic protein receptor, type 1B
SynonymsBMPR-IB, Alk6, Acvrlk6, CFK-43a
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141837136-142169425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141857406 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 259 (L259Q)
Ref Sequence ENSEMBL: ENSMUSP00000101839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
Predicted Effect probably damaging
Transcript: ENSMUST00000029948
AA Change: L259Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: L259Q

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098568
AA Change: L259Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: L259Q

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106230
AA Change: L259Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: L259Q

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106232
AA Change: L259Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: L259Q

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
PIT4366001:Bmpr1b UTSW 3 141880463 missense probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R2912:Bmpr1b UTSW 3 141880378 missense probably benign 0.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5607:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5608:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8136:Bmpr1b UTSW 3 141856382 missense probably damaging 1.00
R8518:Bmpr1b UTSW 3 141857582 missense possibly damaging 0.95
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGTATAACATTTCCAGCCCCTG -3'
(R):5'- GGGTCTTACCAGGTCCAAAG -3'

Sequencing Primer
(F):5'- AGAAGTACCTTAGTCATGCCTCCTG -3'
(R):5'- ACAATAGCTAAGCAAATTCAGATGG -3'
Posted On2018-09-12