Incidental Mutation 'R6826:Copb1'
ID534165
Institutional Source Beutler Lab
Gene Symbol Copb1
Ensembl Gene ENSMUSG00000030754
Gene Namecoatomer protein complex, subunit beta 1
SynonymsCopb1, 2610019B04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_033370; MGI: 1917599

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114215559-114254711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114226719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 677 (T677A)
Ref Sequence ENSEMBL: ENSMUSP00000033012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033012]
Predicted Effect probably benign
Transcript: ENSMUST00000033012
AA Change: T677A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033012
Gene: ENSMUSG00000030754
AA Change: T677A

DomainStartEndE-ValueType
Pfam:Adaptin_N 19 539 2.4e-124 PFAM
low complexity region 643 660 N/A INTRINSIC
Pfam:Coatamer_beta_C 667 807 3.6e-63 PFAM
Pfam:Coatomer_b_Cpla 813 944 3.1e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Copb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Copb1 APN 7 114226776 missense probably benign 0.00
IGL02458:Copb1 APN 7 114246785 missense probably benign 0.00
IGL02549:Copb1 APN 7 114246797 missense probably benign 0.00
IGL02639:Copb1 APN 7 114226595 splice site probably benign
robbers UTSW 7 114248976 missense probably damaging 1.00
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0023:Copb1 UTSW 7 114250094 missense probably benign 0.26
R0631:Copb1 UTSW 7 114233282 missense probably benign 0.12
R1996:Copb1 UTSW 7 114232203 missense probably benign 0.00
R2256:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R2257:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R3853:Copb1 UTSW 7 114223316 missense probably damaging 1.00
R4679:Copb1 UTSW 7 114248976 missense probably damaging 1.00
R4686:Copb1 UTSW 7 114221736 missense possibly damaging 0.94
R5057:Copb1 UTSW 7 114226762 missense probably benign
R5140:Copb1 UTSW 7 114246800 missense probably benign 0.01
R5669:Copb1 UTSW 7 114237585 missense probably damaging 1.00
R5779:Copb1 UTSW 7 114219572 missense probably damaging 1.00
R6017:Copb1 UTSW 7 114236797 missense probably benign 0.07
R6114:Copb1 UTSW 7 114246801 missense probably benign 0.00
R6403:Copb1 UTSW 7 114238451 missense probably damaging 1.00
R6905:Copb1 UTSW 7 114253890 missense probably benign 0.00
R7241:Copb1 UTSW 7 114237356 missense probably damaging 0.96
R7293:Copb1 UTSW 7 114219602 missense probably damaging 1.00
R7485:Copb1 UTSW 7 114245485 missense possibly damaging 0.94
R8103:Copb1 UTSW 7 114234967 missense possibly damaging 0.67
R8427:Copb1 UTSW 7 114226754 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCATAGCAGGACCAGTTAC -3'
(R):5'- TCTATAGAGTGCTTCATAAGTTGGG -3'

Sequencing Primer
(F):5'- AGCAGTTAGTTCCAGGTCAGC -3'
(R):5'- CTGTCCCTGTGAAAGACT -3'
Posted On2018-09-12