Incidental Mutation 'R6826:Myh4'
ID534175
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67246531 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 526 (L526P)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect probably damaging
Transcript: ENSMUST00000018632
AA Change: L526P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: L526P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170942
AA Change: L526P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: L526P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67244724 missense probably benign 0.32
R7365:Myh4 UTSW 11 67242848 missense probably damaging 1.00
R7514:Myh4 UTSW 11 67243322 critical splice donor site probably null
R7553:Myh4 UTSW 11 67256395 missense probably damaging 0.99
R7666:Myh4 UTSW 11 67256281 missense probably damaging 0.99
R7673:Myh4 UTSW 11 67245513 missense probably damaging 1.00
R7685:Myh4 UTSW 11 67240930 missense probably benign 0.13
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67248641 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67253505 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67256271 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGGAACTTATGAACAACTGCTTAC -3'
(R):5'- GATGAAAATGTGAATCCATGTGTGC -3'

Sequencing Primer
(F):5'- ACTGCTTACATTCATTTATCTCTTCC -3'
(R):5'- TTTCTTTCCTGGAGACTACTCTAC -3'
Posted On2018-09-12