Incidental Mutation 'R6826:Slfn14'
ID534176
Institutional Source Beutler Lab
Gene Symbol Slfn14
Ensembl Gene ENSMUSG00000082101
Gene Nameschlafen 14
SynonymsSlfn14-ps, LOC237890
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83275110-83286726 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 83281818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163961]
Predicted Effect probably null
Transcript: ENSMUST00000163961
SMART Domains Protein: ENSMUSP00000139132
Gene: ENSMUSG00000082101

DomainStartEndE-ValueType
Pfam:AAA_4 195 329 1e-20 PFAM
low complexity region 539 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in platelet formation and function. Defects in this gene are a cause of thrombocytopenia with excessive bleeding. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Slfn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03214:Slfn14 APN 11 83279000 missense probably benign 0.01
IGL03402:Slfn14 APN 11 83276313 missense probably benign 0.00
R2520:Slfn14 UTSW 11 83276187 missense probably damaging 0.99
R2570:Slfn14 UTSW 11 83283607 missense probably benign 0.02
R3082:Slfn14 UTSW 11 83276693 nonsense probably null
R4611:Slfn14 UTSW 11 83283314 nonsense probably null
R4647:Slfn14 UTSW 11 83276658 missense probably benign 0.01
R4722:Slfn14 UTSW 11 83283418 missense probably benign 0.27
R4833:Slfn14 UTSW 11 83279156 missense probably damaging 1.00
R4876:Slfn14 UTSW 11 83276272 missense possibly damaging 0.87
R5209:Slfn14 UTSW 11 83279633 missense possibly damaging 0.95
R5776:Slfn14 UTSW 11 83283599 missense probably damaging 1.00
R5933:Slfn14 UTSW 11 83279462 missense probably damaging 0.97
R6174:Slfn14 UTSW 11 83276603 missense probably damaging 1.00
R7042:Slfn14 UTSW 11 83276604 missense probably damaging 1.00
R7070:Slfn14 UTSW 11 83276705 missense probably benign 0.27
R7191:Slfn14 UTSW 11 83276749 missense probably benign
R7207:Slfn14 UTSW 11 83279388 nonsense probably null
R7297:Slfn14 UTSW 11 83278995 nonsense probably null
R7829:Slfn14 UTSW 11 83281817 critical splice donor site probably null
R8094:Slfn14 UTSW 11 83283293 nonsense probably null
R8263:Slfn14 UTSW 11 83283473 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAATTACATGCTATTCATTCCTCCCAG -3'
(R):5'- TGCCTGTAGAAGAACAGCGG -3'

Sequencing Primer
(F):5'- AGTGCTCTTAGCCACTGAGC -3'
(R):5'- AACAGCGGCAGAGTTCTTC -3'
Posted On2018-09-12