Incidental Mutation 'R6826:Dock9'
ID534183
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121622918 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 866 (P866L)
Ref Sequence ENSEMBL: ENSMUSP00000097872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: P864L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: P864L

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: P866L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: P866L

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: P864L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: P878L

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.8884 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense not run
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGAGAGGCTCCAGGTGTG -3'
(R):5'- AGAGGGAGTTCTTCTATCCTTCC -3'

Sequencing Primer
(F):5'- TCCAGGTGTGGACAGACTG -3'
(R):5'- ATGTGAACCTGTTGACCCAG -3'
Posted On2018-09-12