Incidental Mutation 'R6827:Gm572'
ID534199
Institutional Source Beutler Lab
Gene Symbol Gm572
Ensembl Gene ENSMUSG00000070577
Gene Namepredicted gene 572
Synonymsb2b1167Clo, LOC230909
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6827 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148643317-148671572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148658086 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 94 (L94P)
Ref Sequence ENSEMBL: ENSMUSP00000101323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105698
AA Change: L94P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101323
Gene: ENSMUSG00000070577
AA Change: L94P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF4556 144 358 1.9e-117 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele show cardiovascular defects including double outlet right ventricle, dextrocardia and atrioventricular septal defects, heterotaxia with situs inversus totalis and right pulmonary isomerism, spleen hypoplasia, mid-line liver, and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 C A 3: 62,423,498 probably null Het
Asb3 A G 11: 31,101,211 N555S probably benign Het
Bcr T C 10: 75,131,064 V501A probably damaging Het
Cchcr1 A G 17: 35,530,405 T773A possibly damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dscam T A 16: 97,038,991 N139Y probably damaging Het
Ephx1 A G 1: 180,989,888 L406P probably damaging Het
Fbxl13 T A 5: 21,522,178 I607F probably damaging Het
Gm35060 C T 18: 32,458,660 W186* probably null Het
Gm3573 T A 14: 42,188,472 T59S probably benign Het
Gypa A T 8: 80,504,788 M109L probably benign Het
Hk3 C A 13: 55,011,352 V409L probably damaging Het
Kcnh6 A G 11: 106,009,099 T65A probably benign Het
Kdr G T 5: 75,944,545 P1055Q probably damaging Het
Lef1 T C 3: 131,200,404 probably null Het
Lrrc10 A G 10: 117,045,640 Q73R possibly damaging Het
Moxd1 C T 10: 24,279,850 T284I probably benign Het
Naf1 A T 8: 66,877,691 T290S possibly damaging Het
Naip5 C A 13: 100,245,929 V91L possibly damaging Het
Ncaph2 T C 15: 89,371,327 V568A probably damaging Het
Ntrk2 T C 13: 59,126,568 W753R probably damaging Het
Olfr621-ps1 C A 7: 103,629,825 C45F possibly damaging Het
Pbld1 C A 10: 63,067,433 N96K probably damaging Het
Pcdhac2 G A 18: 37,144,653 V229M probably benign Het
Prrc2b G T 2: 32,200,951 R445L probably benign Het
Scyl2 T C 10: 89,669,804 probably null Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Slc22a5 A T 11: 53,871,616 I21N possibly damaging Het
Tmem168 A T 6: 13,582,838 F297L probably damaging Het
Trpm4 T C 7: 45,318,628 E293G possibly damaging Het
Trps1 T A 15: 50,822,563 T69S probably benign Het
Ubxn4 T C 1: 128,276,977 M468T probably benign Het
Unc5b C A 10: 60,780,232 R104L probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Wnt2b A G 3: 104,947,092 V350A probably benign Het
Zfp518b T C 5: 38,671,539 Q1041R probably damaging Het
Zranb1 T C 7: 132,949,745 F68L probably benign Het
Other mutations in Gm572
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Gm572 APN 4 148667392 missense possibly damaging 0.93
IGL01766:Gm572 APN 4 148654895 missense possibly damaging 0.53
IGL02670:Gm572 APN 4 148651228 missense probably benign
IGL02716:Gm572 APN 4 148654870 missense probably benign 0.01
PIT1430001:Gm572 UTSW 4 148671393 missense unknown
R1346:Gm572 UTSW 4 148654897 missense possibly damaging 0.96
R1546:Gm572 UTSW 4 148666819 missense possibly damaging 0.71
R1564:Gm572 UTSW 4 148651186 missense possibly damaging 0.53
R1672:Gm572 UTSW 4 148668509 missense possibly damaging 0.86
R2516:Gm572 UTSW 4 148664384 missense possibly damaging 0.93
R3852:Gm572 UTSW 4 148668872 missense possibly damaging 0.71
R4366:Gm572 UTSW 4 148654865 missense possibly damaging 0.85
R4884:Gm572 UTSW 4 148667362 missense possibly damaging 0.85
R4888:Gm572 UTSW 4 148666845 critical splice donor site probably null
R5026:Gm572 UTSW 4 148654844 missense possibly damaging 0.92
R5121:Gm572 UTSW 4 148666845 critical splice donor site probably null
R5797:Gm572 UTSW 4 148666798 missense probably benign 0.02
R5988:Gm572 UTSW 4 148668507 missense possibly damaging 0.85
R7709:Gm572 UTSW 4 148668951 missense probably damaging 0.98
RF029:Gm572 UTSW 4 148671393 frame shift probably null
RF030:Gm572 UTSW 4 148671393 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGACTTCTGTTGGCGTCCAC -3'
(R):5'- GCCATGGCCATTTCTACAATAG -3'

Sequencing Primer
(F):5'- GTTGGCGTCCACCTTCCG -3'
(R):5'- ATTCTAAGACAGCCAGGTGTCTG -3'
Posted On2018-09-12