Incidental Mutation 'R6827:Unc5b'
ID534210
Institutional Source Beutler Lab
Gene Symbol Unc5b
Ensembl Gene ENSMUSG00000020099
Gene Nameunc-5 netrin receptor B
SynonymsUnc5h2, D10Bwg0792e, 6330415E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6827 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location60762593-60831581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60780232 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 104 (R104L)
Ref Sequence ENSEMBL: ENSMUSP00000151251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]
Predicted Effect probably benign
Transcript: ENSMUST00000077925
AA Change: R104L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: R104L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG_like 54 149 1.71e2 SMART
IGc2 165 232 2.58e-6 SMART
TSP1 249 300 8.21e-15 SMART
TSP1 305 354 2.61e-8 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
ZU5 541 644 1.91e-56 SMART
DEATH 852 943 5.55e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218637
AA Change: R104L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 C A 3: 62,423,498 probably null Het
Asb3 A G 11: 31,101,211 N555S probably benign Het
Bcr T C 10: 75,131,064 V501A probably damaging Het
Cchcr1 A G 17: 35,530,405 T773A possibly damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dscam T A 16: 97,038,991 N139Y probably damaging Het
Ephx1 A G 1: 180,989,888 L406P probably damaging Het
Fbxl13 T A 5: 21,522,178 I607F probably damaging Het
Gm35060 C T 18: 32,458,660 W186* probably null Het
Gm3573 T A 14: 42,188,472 T59S probably benign Het
Gm572 T C 4: 148,658,086 L94P possibly damaging Het
Gypa A T 8: 80,504,788 M109L probably benign Het
Hk3 C A 13: 55,011,352 V409L probably damaging Het
Kcnh6 A G 11: 106,009,099 T65A probably benign Het
Kdr G T 5: 75,944,545 P1055Q probably damaging Het
Lef1 T C 3: 131,200,404 probably null Het
Lrrc10 A G 10: 117,045,640 Q73R possibly damaging Het
Moxd1 C T 10: 24,279,850 T284I probably benign Het
Naf1 A T 8: 66,877,691 T290S possibly damaging Het
Naip5 C A 13: 100,245,929 V91L possibly damaging Het
Ncaph2 T C 15: 89,371,327 V568A probably damaging Het
Ntrk2 T C 13: 59,126,568 W753R probably damaging Het
Olfr621-ps1 C A 7: 103,629,825 C45F possibly damaging Het
Pbld1 C A 10: 63,067,433 N96K probably damaging Het
Pcdhac2 G A 18: 37,144,653 V229M probably benign Het
Prrc2b G T 2: 32,200,951 R445L probably benign Het
Scyl2 T C 10: 89,669,804 probably null Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Slc22a5 A T 11: 53,871,616 I21N possibly damaging Het
Tmem168 A T 6: 13,582,838 F297L probably damaging Het
Trpm4 T C 7: 45,318,628 E293G possibly damaging Het
Trps1 T A 15: 50,822,563 T69S probably benign Het
Ubxn4 T C 1: 128,276,977 M468T probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Wnt2b A G 3: 104,947,092 V350A probably benign Het
Zfp518b T C 5: 38,671,539 Q1041R probably damaging Het
Zranb1 T C 7: 132,949,745 F68L probably benign Het
Other mutations in Unc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Unc5b APN 10 60783216 missense possibly damaging 0.73
IGL00578:Unc5b APN 10 60767055 missense probably damaging 1.00
IGL01895:Unc5b APN 10 60767085 missense probably damaging 1.00
IGL01955:Unc5b APN 10 60778255 missense probably benign 0.30
IGL01980:Unc5b APN 10 60780187 missense probably damaging 1.00
IGL02277:Unc5b APN 10 60774742 missense probably benign
LCD18:Unc5b UTSW 10 60786171 intron probably benign
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0026:Unc5b UTSW 10 60774592 missense possibly damaging 0.86
R0147:Unc5b UTSW 10 60772297 missense probably damaging 0.96
R0305:Unc5b UTSW 10 60779658 splice site probably benign
R0306:Unc5b UTSW 10 60779658 splice site probably benign
R0373:Unc5b UTSW 10 60778940 missense possibly damaging 0.78
R0662:Unc5b UTSW 10 60772583 missense possibly damaging 0.68
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1512:Unc5b UTSW 10 60831475 unclassified probably benign
R1532:Unc5b UTSW 10 60769232 missense probably damaging 0.99
R1916:Unc5b UTSW 10 60778248 missense probably damaging 1.00
R1931:Unc5b UTSW 10 60772569 missense probably benign 0.30
R1954:Unc5b UTSW 10 60769265 splice site probably benign
R2350:Unc5b UTSW 10 60778200 missense probably benign 0.04
R3419:Unc5b UTSW 10 60778814 missense probably damaging 1.00
R4116:Unc5b UTSW 10 60774700 missense probably damaging 0.99
R4258:Unc5b UTSW 10 60765371 missense probably damaging 0.99
R4329:Unc5b UTSW 10 60783190 missense probably damaging 1.00
R4605:Unc5b UTSW 10 60774403 missense probably benign 0.01
R4828:Unc5b UTSW 10 60772348 missense possibly damaging 0.90
R5134:Unc5b UTSW 10 60775100 missense probably benign 0.09
R5190:Unc5b UTSW 10 60772293 missense probably benign 0.04
R5240:Unc5b UTSW 10 60774640 missense probably damaging 0.99
R5342:Unc5b UTSW 10 60778267 nonsense probably null
R5522:Unc5b UTSW 10 60778195 missense possibly damaging 0.91
R5694:Unc5b UTSW 10 60773747 missense probably benign 0.02
R5822:Unc5b UTSW 10 60772527 missense possibly damaging 0.71
R5909:Unc5b UTSW 10 60772359 missense probably damaging 1.00
R6007:Unc5b UTSW 10 60765360 missense probably damaging 1.00
R6115:Unc5b UTSW 10 60777546 missense probably benign 0.33
R6182:Unc5b UTSW 10 60765236 missense probably damaging 1.00
R6187:Unc5b UTSW 10 60772224 missense probably damaging 1.00
R6294:Unc5b UTSW 10 60778331 missense possibly damaging 0.82
R6319:Unc5b UTSW 10 60778801 missense probably damaging 1.00
R6366:Unc5b UTSW 10 60778312 missense probably benign
R6532:Unc5b UTSW 10 60778828 missense possibly damaging 0.95
R6912:Unc5b UTSW 10 60831092 missense probably benign
R7032:Unc5b UTSW 10 60778808 missense probably damaging 0.99
R7082:Unc5b UTSW 10 60775088 missense probably damaging 0.98
R7089:Unc5b UTSW 10 60777486 missense probably damaging 1.00
R7270:Unc5b UTSW 10 60772223 nonsense probably null
R7587:Unc5b UTSW 10 60783120 missense probably damaging 1.00
R7716:Unc5b UTSW 10 60777438 missense probably damaging 1.00
R7750:Unc5b UTSW 10 60775044 missense probably benign 0.00
R7810:Unc5b UTSW 10 60765241 missense probably benign
R7895:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
R7978:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
RF019:Unc5b UTSW 10 60783183 missense probably damaging 1.00
X0027:Unc5b UTSW 10 60777459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACAGTGGGAGGGTATTTCTC -3'
(R):5'- ACCTGGGTCTTTCTGCTGAG -3'

Sequencing Primer
(F):5'- CTCTTTCTGATCTCTATGGGGAAG -3'
(R):5'- GTCTTTCTGCTGAGGCTAGC -3'
Posted On2018-09-12