Incidental Mutation 'R6828:Crb2'
ID534235
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6828 (G1)
Quality Score101.467
Status Not validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACTGCTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC at 37776409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect probably benign
Transcript: ENSMUST00000050372
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,817 T667A possibly damaging Het
Abca17 A T 17: 24,326,415 M349K possibly damaging Het
Akap12 A G 10: 4,354,606 E472G probably damaging Het
Ap2s1 T C 7: 16,748,701 Y94H probably damaging Het
Apeh A G 9: 108,087,038 F530L probably damaging Het
Aplnr G A 2: 85,139,759 probably benign Het
Arid3b A G 9: 57,810,163 probably null Het
Ash1l A C 3: 89,076,113 D2874A probably benign Het
Aurka T A 2: 172,357,252 R277S probably damaging Het
Ccar1 C A 10: 62,764,430 W574L probably damaging Het
Cd8b1 T C 6: 71,334,116 F207L probably benign Het
Clec14a T C 12: 58,268,504 R111G probably damaging Het
Clk3 G A 9: 57,760,849 T263I possibly damaging Het
Col11a2 A G 17: 34,053,633 probably null Het
Col5a3 C T 9: 20,798,452 G604D unknown Het
Ctps A T 4: 120,548,138 V369D probably damaging Het
Dennd5b A G 6: 148,993,746 I1262T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Fam170b A G 14: 32,835,958 D250G probably damaging Het
Fam26d A G 10: 34,043,957 F105L possibly damaging Het
Foxs1 G A 2: 152,933,128 Q2* probably null Het
Frmpd1 T C 4: 45,275,383 V512A probably damaging Het
Fry G A 5: 150,466,446 probably null Het
Gria1 A G 11: 57,289,462 Y677C probably damaging Het
Igdcc4 T C 9: 65,122,697 I343T probably benign Het
Igkv1-132 T C 6: 67,759,713 V5A probably benign Het
Ikzf5 A T 7: 131,391,672 C256S probably damaging Het
Itk G A 11: 46,341,218 H297Y probably damaging Het
Lamb3 A G 1: 193,335,448 E879G probably benign Het
Lpin2 T C 17: 71,222,128 V127A probably damaging Het
Man2b1 C A 8: 85,086,919 P247T possibly damaging Het
Mxd3 T C 13: 55,326,154 K122E probably benign Het
Npr1 C A 3: 90,464,813 V231L probably benign Het
Nsd2 C T 5: 33,893,568 A1263V probably damaging Het
Olfm4 A G 14: 80,021,533 D374G probably damaging Het
Olfr508 A C 7: 108,630,293 Q100H possibly damaging Het
Olfr803 A T 10: 129,691,994 S16T probably damaging Het
Optc A T 1: 133,897,867 I307N probably damaging Het
Pecr C A 1: 72,267,457 E222* probably null Het
Pibf1 A G 14: 99,186,551 N520S probably benign Het
Rhoj A G 12: 75,308,879 N19S probably benign Het
Rock2 G A 12: 16,942,959 probably null Het
Rpa1 G A 11: 75,314,871 T220I probably damaging Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sipa1l3 G A 7: 29,339,032 H397Y probably benign Het
Snrk T C 9: 122,137,566 I185T probably damaging Het
Srrt A T 5: 137,296,968 V300E probably damaging Het
Taok2 A T 7: 126,871,875 probably null Het
Tldc1 G A 8: 119,772,567 T62I possibly damaging Het
Tmem131 T C 1: 36,804,643 K1379R possibly damaging Het
Usp15 T C 10: 123,127,989 I543V probably damaging Het
Zfp553 A G 7: 127,236,275 E334G probably damaging Het
Zim1 T C 7: 6,677,689 Y325C probably damaging Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACAAGCCCCAGGAATCTTGG -3'
(R):5'- TCTCCAAGTGAGTCCCAAGAC -3'

Sequencing Primer
(F):5'- AATCTTGGCTGGCCCCATG -3'
(R):5'- GTGAGTCCCAAGACACCCG -3'
Posted On2018-09-12