Incidental Mutation 'R6828:Ctps'
ID534242
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6828 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120548138 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 369 (V369D)
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably damaging
Transcript: ENSMUST00000030381
AA Change: V369D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: V369D

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,817 T667A possibly damaging Het
Abca17 A T 17: 24,326,415 M349K possibly damaging Het
Akap12 A G 10: 4,354,606 E472G probably damaging Het
Ap2s1 T C 7: 16,748,701 Y94H probably damaging Het
Apeh A G 9: 108,087,038 F530L probably damaging Het
Aplnr G A 2: 85,139,759 probably benign Het
Arid3b A G 9: 57,810,163 probably null Het
Ash1l A C 3: 89,076,113 D2874A probably benign Het
Aurka T A 2: 172,357,252 R277S probably damaging Het
Ccar1 C A 10: 62,764,430 W574L probably damaging Het
Cd8b1 T C 6: 71,334,116 F207L probably benign Het
Clec14a T C 12: 58,268,504 R111G probably damaging Het
Clk3 G A 9: 57,760,849 T263I possibly damaging Het
Col11a2 A G 17: 34,053,633 probably null Het
Col5a3 C T 9: 20,798,452 G604D unknown Het
Crb2 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 2: 37,776,409 probably benign Het
Dennd5b A G 6: 148,993,746 I1262T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Fam170b A G 14: 32,835,958 D250G probably damaging Het
Fam26d A G 10: 34,043,957 F105L possibly damaging Het
Foxs1 G A 2: 152,933,128 Q2* probably null Het
Frmpd1 T C 4: 45,275,383 V512A probably damaging Het
Fry G A 5: 150,466,446 probably null Het
Gria1 A G 11: 57,289,462 Y677C probably damaging Het
Igdcc4 T C 9: 65,122,697 I343T probably benign Het
Igkv1-132 T C 6: 67,759,713 V5A probably benign Het
Ikzf5 A T 7: 131,391,672 C256S probably damaging Het
Itk G A 11: 46,341,218 H297Y probably damaging Het
Lamb3 A G 1: 193,335,448 E879G probably benign Het
Lpin2 T C 17: 71,222,128 V127A probably damaging Het
Man2b1 C A 8: 85,086,919 P247T possibly damaging Het
Mxd3 T C 13: 55,326,154 K122E probably benign Het
Npr1 C A 3: 90,464,813 V231L probably benign Het
Nsd2 C T 5: 33,893,568 A1263V probably damaging Het
Olfm4 A G 14: 80,021,533 D374G probably damaging Het
Olfr508 A C 7: 108,630,293 Q100H possibly damaging Het
Olfr803 A T 10: 129,691,994 S16T probably damaging Het
Optc A T 1: 133,897,867 I307N probably damaging Het
Pecr C A 1: 72,267,457 E222* probably null Het
Pibf1 A G 14: 99,186,551 N520S probably benign Het
Rhoj A G 12: 75,308,879 N19S probably benign Het
Rock2 G A 12: 16,942,959 probably null Het
Rpa1 G A 11: 75,314,871 T220I probably damaging Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sipa1l3 G A 7: 29,339,032 H397Y probably benign Het
Snrk T C 9: 122,137,566 I185T probably damaging Het
Srrt A T 5: 137,296,968 V300E probably damaging Het
Taok2 A T 7: 126,871,875 probably null Het
Tldc1 G A 8: 119,772,567 T62I possibly damaging Het
Tmem131 T C 1: 36,804,643 K1379R possibly damaging Het
Usp15 T C 10: 123,127,989 I543V probably damaging Het
Zfp553 A G 7: 127,236,275 E334G probably damaging Het
Zim1 T C 7: 6,677,689 Y325C probably damaging Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3928:Ctps UTSW 4 120541896 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTCATCTGCATGCAGCTC -3'
(R):5'- GCTCATGTCCTTGTTTGCATTAAG -3'

Sequencing Primer
(F):5'- ACAGACCTTGGCAAGTTGTC -3'
(R):5'- AAGCTCCTTGTATTTATAAGCACAG -3'
Posted On2018-09-12