Incidental Mutation 'R6829:Slc2a2'
ID534290
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 2
SynonymsGlut2, liver-type glucose transporter, Glut-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6829 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location28697903-28731359 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 28727441 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 513 (Q513*)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
Predicted Effect probably null
Transcript: ENSMUST00000029240
AA Change: Q513*
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: Q513*

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163536
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,226,568 *295Q probably null Het
Adam2 A T 14: 66,027,997 probably null Het
Adamts5 A T 16: 85,870,071 M511K possibly damaging Het
Adcy9 A G 16: 4,307,154 probably null Het
Cast T C 13: 74,728,344 E113G possibly damaging Het
Dcaf1 T A 9: 106,838,604 S307T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Elac2 A G 11: 64,989,364 E111G probably benign Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fbxw4 A G 19: 45,636,374 F57S possibly damaging Het
Gm17655 T G 5: 110,046,926 H330P probably damaging Het
Gm2a T C 11: 55,103,750 probably null Het
Gon4l T A 3: 88,880,106 D600E possibly damaging Het
Gsg1l2 T C 11: 67,774,858 I84T possibly damaging Het
Igsf9 A G 1: 172,495,674 R652G probably benign Het
Il17rd C T 14: 27,087,422 R112* probably null Het
Jph1 C A 1: 17,004,423 R457L probably damaging Het
Khdrbs3 T C 15: 69,092,961 V249A possibly damaging Het
Mocs2 A G 13: 114,819,444 S43G probably benign Het
Myom2 T A 8: 15,122,643 L1190* probably null Het
Olfr1080 A T 2: 86,553,269 L285* probably null Het
Olfr1318 G C 2: 112,155,794 probably benign Het
Olfr198 A G 16: 59,201,535 V297A probably damaging Het
Olfr263 T A 13: 21,132,853 I26N possibly damaging Het
Pgc A T 17: 47,732,781 probably null Het
Plch1 T G 3: 63,697,518 D1655A probably damaging Het
Pnliprp2 G A 19: 58,759,873 G29R probably benign Het
Polg A G 7: 79,460,109 V382A probably benign Het
Rb1cc1 T C 1: 6,249,264 I969T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sema7a A G 9: 57,960,898 E538G probably benign Het
Slc4a8 A G 15: 100,800,538 Y636C probably damaging Het
Trpm5 A G 7: 143,069,429 probably benign Het
Vmn1r14 T C 6: 57,233,551 L38P probably benign Het
Washc4 T C 10: 83,560,516 S397P probably damaging Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zan A G 5: 137,416,278 probably benign Het
Zfhx3 C T 8: 108,950,283 T2655M probably damaging Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28718741 missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28708488 missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28717472 missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28705803 missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28719401 missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28698025 missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28717455 missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28727111 missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28718736 missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28726290 missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28719370 missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28708679 critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28727277 missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28718816 missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28717488 missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28713662 splice site probably null
R1965:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28717441 missense probably benign 0.36
R2937:Slc2a2 UTSW 3 28718771 missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28721749 missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28727152 missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28717532 critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28708607 missense probably damaging 1.00
R6864:Slc2a2 UTSW 3 28721725 missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28717519 missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28719482 missense possibly damaging 0.90
R7599:Slc2a2 UTSW 3 28698017 start codon destroyed probably null 0.02
R7616:Slc2a2 UTSW 3 28727111 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGACTTCCTTGGGCCTTAC -3'
(R):5'- AGCCTCTGGTTTACTGAAGAGTG -3'

Sequencing Primer
(F):5'- CCTTGGGCCTTACGTGTTC -3'
(R):5'- CTGGTTTACTGAAGAGTGTTACCATC -3'
Posted On2018-09-12