Incidental Mutation 'R6829:Adamts5'
ID 534319
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms 9530092O11Rik, ADAM-TS5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R6829 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 85856173-85901828 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85870071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 511 (M511K)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
AlphaFold Q9R001
Predicted Effect possibly damaging
Transcript: ENSMUST00000023611
AA Change: M511K

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: M511K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,226,568 *295Q probably null Het
Adam2 A T 14: 66,027,997 probably null Het
Adcy9 A G 16: 4,307,154 probably null Het
Cast T C 13: 74,728,344 E113G possibly damaging Het
Dcaf1 T A 9: 106,838,604 S307T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Elac2 A G 11: 64,989,364 E111G probably benign Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fbxw4 A G 19: 45,636,374 F57S possibly damaging Het
Gm17655 T G 5: 110,046,926 H330P probably damaging Het
Gm2a T C 11: 55,103,750 probably null Het
Gon4l T A 3: 88,880,106 D600E possibly damaging Het
Gsg1l2 T C 11: 67,774,858 I84T possibly damaging Het
Igsf9 A G 1: 172,495,674 R652G probably benign Het
Il17rd C T 14: 27,087,422 R112* probably null Het
Jph1 C A 1: 17,004,423 R457L probably damaging Het
Khdrbs3 T C 15: 69,092,961 V249A possibly damaging Het
Mocs2 A G 13: 114,819,444 S43G probably benign Het
Myom2 T A 8: 15,122,643 L1190* probably null Het
Olfr1080 A T 2: 86,553,269 L285* probably null Het
Olfr1318 G C 2: 112,155,794 probably benign Het
Olfr198 A G 16: 59,201,535 V297A probably damaging Het
Olfr263 T A 13: 21,132,853 I26N possibly damaging Het
Pgc A T 17: 47,732,781 probably null Het
Plch1 T G 3: 63,697,518 D1655A probably damaging Het
Pnliprp2 G A 19: 58,759,873 G29R probably benign Het
Polg A G 7: 79,460,109 V382A probably benign Het
Rb1cc1 T C 1: 6,249,264 I969T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sema7a A G 9: 57,960,898 E538G probably benign Het
Slc2a2 C T 3: 28,727,441 Q513* probably null Het
Slc4a8 A G 15: 100,800,538 Y636C probably damaging Het
Trpm5 A G 7: 143,069,429 probably benign Het
Vmn1r14 T C 6: 57,233,551 L38P probably benign Het
Washc4 T C 10: 83,560,516 S397P probably damaging Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zan A G 5: 137,416,278 probably benign Het
Zfhx3 C T 8: 108,950,283 T2655M probably damaging Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
R8804:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R9209:Adamts5 UTSW 16 85870083 missense probably damaging 1.00
R9455:Adamts5 UTSW 16 85870129 missense probably damaging 0.99
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGGAAAAGCACTTCC -3'
(R):5'- TACTTCTTAGGTCGCTGGTTATAGC -3'

Sequencing Primer
(F):5'- CTGTGTTGGGTCTCGCCAC -3'
(R):5'- GGTCGCTGGTTATAGCAATTTGAAAC -3'
Posted On 2018-09-12