Incidental Mutation 'R6830:Macrod2'
ID534331
Institutional Source Beutler Lab
Gene Symbol Macrod2
Ensembl Gene ENSMUSG00000068205
Gene NameMACRO domain containing 2
Synonyms2900006F19Rik, 1110033L15Rik, 2610107G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location140395309-142392966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140452682 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 89 (N89K)
Ref Sequence ENSEMBL: ENSMUSP00000105694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078027] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect probably damaging
Transcript: ENSMUST00000078027
AA Change: N89K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205
AA Change: N89K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110063
AA Change: N89K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205
AA Change: N89K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110064
AA Change: N89K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205
AA Change: N89K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110067
AA Change: N89K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205
AA Change: N89K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Meta Mutation Damage Score 0.7754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Macrod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Macrod2 APN 2 140400877 missense probably damaging 0.99
IGL00661:Macrod2 APN 2 140419904 critical splice acceptor site probably null
IGL00788:Macrod2 APN 2 142210149 splice site probably benign
IGL00840:Macrod2 APN 2 142176658 missense possibly damaging 0.53
IGL01160:Macrod2 APN 2 140825042 splice site probably benign
IGL01357:Macrod2 APN 2 142384330 missense probably damaging 1.00
IGL01453:Macrod2 APN 2 140452572 splice site probably benign
IGL01910:Macrod2 APN 2 142296565 missense probably benign 0.04
IGL02208:Macrod2 APN 2 142374276 missense possibly damaging 0.55
IGL03013:Macrod2 APN 2 141515227 missense probably benign 0.02
R0196:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R0415:Macrod2 UTSW 2 142210145 critical splice donor site probably null
R0699:Macrod2 UTSW 2 140418916 critical splice donor site probably null
R0730:Macrod2 UTSW 2 142217674 splice site probably benign
R1119:Macrod2 UTSW 2 140400906 missense probably benign 0.00
R1124:Macrod2 UTSW 2 140452627 missense probably damaging 1.00
R1422:Macrod2 UTSW 2 140419941 splice site probably null
R3707:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3708:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3745:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R4409:Macrod2 UTSW 2 140418857 missense possibly damaging 0.66
R4666:Macrod2 UTSW 2 142217599 missense probably damaging 0.99
R4782:Macrod2 UTSW 2 140419938 missense possibly damaging 0.81
R4885:Macrod2 UTSW 2 140420065 missense possibly damaging 0.66
R5180:Macrod2 UTSW 2 140395716 missense probably damaging 1.00
R5524:Macrod2 UTSW 2 142317943 missense possibly damaging 0.82
R5677:Macrod2 UTSW 2 142176667 missense probably damaging 1.00
R5735:Macrod2 UTSW 2 140418889 missense possibly damaging 0.66
R5750:Macrod2 UTSW 2 141515320 missense probably benign 0.41
R5770:Macrod2 UTSW 2 141232182 intron probably benign
R6029:Macrod2 UTSW 2 142318447 missense probably damaging 0.99
R6174:Macrod2 UTSW 2 140400975 start codon destroyed probably null
R6453:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R6927:Macrod2 UTSW 2 142256521 missense probably damaging 1.00
R6932:Macrod2 UTSW 2 140419913 missense probably damaging 0.97
R7020:Macrod2 UTSW 2 142389875 makesense probably null
R7886:Macrod2 UTSW 2 141724645 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 140706208 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 141024090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACACAGATGAGTACACAC -3'
(R):5'- GCATGAAACCAGTAATCATTTAGCG -3'

Sequencing Primer
(F):5'- GCACACAGATGAGTACACACAAGAAG -3'
(R):5'- GCGACTAAAATTCTTTCTGAAGAGC -3'
Posted On2018-09-12