Mutagenetix > Incidental Mutation

Incidental Mutation 'R6830:Rpe65'

534337

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R6830 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 159614168 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 225 (V225A)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably benign
Transcript: ENSMUST00000029824
AA Change: V225A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: V225A

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196999
AA Change: V225A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: V225A

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,176,184	S135P	probably benign	Het
4930503B20Rik	T	C	3: 146,650,961	D64G	possibly damaging	Het
Amtn	T	C	5: 88,378,097	L40P	probably damaging	Het
Ano6	A	G	15: 95,894,461	R90G	probably damaging	Het
Arfgef3	A	C	10: 18,664,889		probably null	Het
Asxl3	C	T	18: 22,525,388	P2152S	probably benign	Het
Atp7b	A	T	8: 22,022,365	V494E	probably damaging	Het
Bik	T	A	15: 83,544,208	Y146N	probably benign	Het
C1qtnf7	A	T	5: 43,609,094	I12F	possibly damaging	Het
Cacna1e	A	G	1: 154,413,974		probably null	Het
Ccnj	A	G	19: 40,845,192	E231G	probably damaging	Het
Cd101	T	C	3: 100,993,696	K1020R	probably benign	Het
Cdh6	C	A	15: 13,044,774	V421L	probably benign	Het
Decr1	T	C	4: 15,924,355		probably null	Het
Dmxl1	C	T	18: 49,921,024	P2566S	probably damaging	Het
Dock9	G	A	14: 121,622,918	P866L	probably damaging	Het
Epx	A	G	11: 87,868,626	F546L	probably damaging	Het
Fat4	T	A	3: 38,981,817	M3206K	probably benign	Het
Fgb	T	C	3: 83,045,025	D179G	probably benign	Het
Gbgt1	A	G	2: 28,505,208	D286G	probably damaging	Het
Gm8251	A	G	1: 44,056,730	V1736A	probably benign	Het
Gpn1	T	A	5: 31,507,488	S285R	probably benign	Het
Htt	T	A	5: 34,834,326	Y1212N	possibly damaging	Het
Kcnj13	T	C	1: 87,387,023	K159R	probably damaging	Het
Ldb2	T	A	5: 44,541,857	I80F	probably damaging	Het
Macrod2	T	A	2: 140,452,682	N89K	probably damaging	Het
Mdga2	G	A	12: 66,723,001	R173C	probably damaging	Het
Mroh9	A	G	1: 163,076,366	F26L	probably benign	Het
Neil3	G	T	8: 53,599,479	N361K	probably benign	Het
Nepro	A	G	16: 44,731,357	R193G	probably damaging	Het
Olfr653	T	A	7: 104,580,240	I198N	probably damaging	Het
Pclo	A	T	5: 14,681,099	Q3205L	unknown	Het
Plekhm1	A	T	11: 103,376,889	I752N	probably damaging	Het
Podn	T	C	4: 108,021,417	T273A	possibly damaging	Het
Prep	T	A	10: 45,097,501	M235K	probably benign	Het
Ptprc	A	T	1: 138,072,255		probably null	Het
Reg2	A	G	6: 78,407,642	H119R	possibly damaging	Het
Scn9a	T	C	2: 66,568,029	D79G	probably damaging	Het
Slc25a23	G	A	17: 57,053,804	R9*	probably null	Het
Snai3	A	G	8: 122,456,473	L111P	probably damaging	Het
Stk38	A	G	17: 29,000,007		probably null	Het
Stk38l	A	T	6: 146,766,771	I115F	possibly damaging	Het
Tmco6	T	A	18: 36,738,353		probably null	Het
Tollip	A	T	7: 141,898,714	M1K	probably null	Het
Trim40	T	C	17: 36,888,850	Y112C	possibly damaging	Het
Ttc27	T	A	17: 74,856,555	Y719*	probably null	Het
Ubald1	T	C	16: 4,879,720	D6G	probably damaging	Het
Vmn2r59	A	T	7: 42,043,747	S476R	probably benign	Het
Wfdc3	C	T	2: 164,734,258	G38R	possibly damaging	Het
Zbtb21	C	T	16: 97,951,961	G402D	probably damaging	Het
Zfp84	A	G	7: 29,776,486	Y201C	probably benign	Het
Zswim2	T	A	2: 83,939,684	H62L	probably damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTTGGTGGGACCCTTAGG -3'
(R):5'- GTGGGTAAGCGTCTACACAAAG -3'

Sequencing Primer
(F):5'- GAGCTATGAAAAATCCACATCTGAAG -3'
(R):5'- CTCAGATTTACAGTGCTTACATGG -3'

Posted On

2018-09-12