Incidental Mutation 'R6830:Decr1'
ID534338
Institutional Source Beutler Lab
Gene Symbol Decr1
Ensembl Gene ENSMUSG00000028223
Gene Name2,4-dienoyl CoA reductase 1, mitochondrial
SynonymsNadph, 1200012F07Rik, Decr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location15917240-15945507 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 15924355 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029877]
Predicted Effect probably null
Transcript: ENSMUST00000029877
SMART Domains Protein: ENSMUSP00000029877
Gene: ENSMUSG00000028223

DomainStartEndE-ValueType
Pfam:adh_short 60 253 7.7e-34 PFAM
Pfam:KR 61 182 4.3e-9 PFAM
Pfam:adh_short_C2 66 304 2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an accessory enzyme which participates in the beta-oxidation and metabolism of unsaturated fatty enoyl-CoA esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to fasting and cold stresses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Decr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Decr1 APN 4 15933056 missense probably benign 0.23
IGL02736:Decr1 APN 4 15930952 missense probably benign 0.01
IGL03141:Decr1 APN 4 15932902 missense probably damaging 1.00
I1329:Decr1 UTSW 4 15930976 nonsense probably null
R0472:Decr1 UTSW 4 15919849 missense probably damaging 1.00
R1295:Decr1 UTSW 4 15919207 missense possibly damaging 0.93
R1898:Decr1 UTSW 4 15929801 missense probably damaging 1.00
R1955:Decr1 UTSW 4 15924256 missense probably benign 0.09
R3160:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R4545:Decr1 UTSW 4 15930979 missense probably damaging 1.00
R4962:Decr1 UTSW 4 15930976 nonsense probably null
R5188:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5190:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5215:Decr1 UTSW 4 15929795 missense probably damaging 1.00
R5556:Decr1 UTSW 4 15919244 missense probably damaging 1.00
R6164:Decr1 UTSW 4 15924347 missense probably benign 0.32
R6253:Decr1 UTSW 4 15931179 missense probably benign 0.00
R6313:Decr1 UTSW 4 15924261 missense probably benign 0.00
R6998:Decr1 UTSW 4 15930960 missense probably damaging 1.00
R7064:Decr1 UTSW 4 15945392
R8052:Decr1 UTSW 4 15933019 missense probably benign 0.00
R8698:Decr1 UTSW 4 15922483 critical splice donor site probably null
R8806:Decr1 UTSW 4 15945351 start codon destroyed probably benign 0.01
X0026:Decr1 UTSW 4 15919846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACGTGGCCAGACATAG -3'
(R):5'- TTCTACAGACATTAAGACCAGGAG -3'

Sequencing Primer
(F):5'- TGGCCAGACATAGCTTGCTC -3'
(R):5'- CCAGGAGTAAGACGATACACTTTTC -3'
Posted On2018-09-12