Incidental Mutation 'R6830:Podn'
ID534339
Institutional Source Beutler Lab
Gene Symbol Podn
Ensembl Gene ENSMUSG00000028600
Gene Namepodocan
SynonymsSLRR5A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108014791-108096445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108021417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000121478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000146851]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044248
AA Change: T418A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600
AA Change: T418A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106708
AA Change: T418A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600
AA Change: T418A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106709
AA Change: T418A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600
AA Change: T418A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123184
Gene: ENSMUSG00000028600
AA Change: T37A

DomainStartEndE-ValueType
LRR 27 49 1.53e2 SMART
LRR_TYP 50 73 7.37e-4 SMART
LRR 95 120 1.66e1 SMART
LRR 121 139 3.09e2 SMART
low complexity region 188 203 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146851
AA Change: T273A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600
AA Change: T273A

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the small leucine-rich repeat protein family and contains an amino terminal CX3CXCX7C cysteine-rich cluster followed by a leucine-rich repeat domain. Studies suggest that this protein could function to inhibit smooth muscle cell proliferation and migration following arterial injury. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Podn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Podn APN 4 108022174 missense probably damaging 1.00
IGL01569:Podn APN 4 108024299 missense probably damaging 1.00
IGL02950:Podn APN 4 108017851 missense possibly damaging 0.65
R0119:Podn UTSW 4 108021594 missense probably damaging 1.00
R0196:Podn UTSW 4 108021498 missense probably damaging 1.00
R0499:Podn UTSW 4 108021594 missense probably damaging 1.00
R1539:Podn UTSW 4 108021567 missense probably damaging 1.00
R1705:Podn UTSW 4 108017858 missense probably benign 0.24
R2018:Podn UTSW 4 108023373 missense probably damaging 1.00
R2120:Podn UTSW 4 108023361 missense probably damaging 1.00
R2156:Podn UTSW 4 108021695 missense probably damaging 1.00
R2170:Podn UTSW 4 108022533 missense probably damaging 1.00
R2200:Podn UTSW 4 108022590 missense probably damaging 0.99
R2384:Podn UTSW 4 108022072 missense probably damaging 1.00
R4285:Podn UTSW 4 108021696 missense possibly damaging 0.69
R4606:Podn UTSW 4 108017867 missense probably benign 0.07
R5051:Podn UTSW 4 108014846 missense probably benign 0.15
R5945:Podn UTSW 4 108021713 missense possibly damaging 0.88
R6317:Podn UTSW 4 108027160 missense probably damaging 0.99
R6366:Podn UTSW 4 108018804 missense possibly damaging 0.95
R6983:Podn UTSW 4 108024273 splice site probably null
R7325:Podn UTSW 4 108017702 splice site probably null
R7456:Podn UTSW 4 108017805 missense probably benign 0.05
R7516:Podn UTSW 4 108022124 missense probably damaging 1.00
X0004:Podn UTSW 4 108021567 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GTAGTACCTGCAGACCAGCAAG -3'
(R):5'- GCTCCACACAGTGCATCTATAC -3'

Sequencing Primer
(F):5'- CCTGTGAGGTAGAGTTCCCGAAG -3'
(R):5'- TCTATACAACAACGCGCTGG -3'
Posted On2018-09-12