Incidental Mutation 'R6830:Vmn2r59'
ID534349
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Namevomeronasal 2, receptor 59
SynonymsEG628444
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location42011792-42058981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42043747 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 476 (S476R)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
Predicted Effect probably benign
Transcript: ENSMUST00000168489
AA Change: S476R

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: S476R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 42012064 missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 42012559 missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 42046169 missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 42012393 missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 42012231 missense probably benign
IGL03346:Vmn2r59 APN 7 42043829 missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 42058916 missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 42012438 missense probably benign
PIT4366001:Vmn2r59 UTSW 7 42045781 missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 42046301 missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 42012298 missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 42047008 nonsense probably null
R0370:Vmn2r59 UTSW 7 42012726 missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 42046492 splice site probably benign
R0465:Vmn2r59 UTSW 7 42046908 missense probably benign
R0487:Vmn2r59 UTSW 7 42047104 nonsense probably null
R0576:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R0632:Vmn2r59 UTSW 7 42058884 missense probably damaging 1.00
R1356:Vmn2r59 UTSW 7 42011794 makesense probably null
R1387:Vmn2r59 UTSW 7 42046097 missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 42045709 missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 42046205 missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 42045827 missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 42043779 missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 42058902 missense probably benign 0.00
R2256:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2257:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2441:Vmn2r59 UTSW 7 42046146 missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 42043766 missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 42011946 missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 42046320 missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 42021308 intron probably benign
R4357:Vmn2r59 UTSW 7 42012220 missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 42042450 missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 42046073 missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 42046224 missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 42012438 missense probably benign
R4653:Vmn2r59 UTSW 7 42043804 missense probably benign 0.19
R4703:Vmn2r59 UTSW 7 42012262 missense probably benign 0.01
R4895:Vmn2r59 UTSW 7 42045794 missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 42043653 missense probably benign
R5045:Vmn2r59 UTSW 7 42046072 missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 42042410 critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 42046823 missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 42045681 missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 42045894 missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 42058767 splice site probably null
R5625:Vmn2r59 UTSW 7 42046460 missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 42046044 missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 42046067 missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 42012325 nonsense probably null
R6196:Vmn2r59 UTSW 7 42012255 missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 42042411 critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6625:Vmn2r59 UTSW 7 42043753 missense probably benign 0.02
R6690:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 42011968 missense probably benign 0.17
R6859:Vmn2r59 UTSW 7 42043853 missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 42045764 missense probably damaging 1.00
R7556:Vmn2r59 UTSW 7 42045809 missense probably damaging 1.00
R7733:Vmn2r59 UTSW 7 42012019 missense probably benign 0.17
R7770:Vmn2r59 UTSW 7 42058912 missense probably damaging 1.00
R7812:Vmn2r59 UTSW 7 42045772 nonsense probably null
R7867:Vmn2r59 UTSW 7 42012283 missense probably damaging 1.00
R7975:Vmn2r59 UTSW 7 42043775 missense probably damaging 1.00
R7999:Vmn2r59 UTSW 7 42046832 missense probably damaging 1.00
R8267:Vmn2r59 UTSW 7 42012097 missense probably damaging 0.97
R8367:Vmn2r59 UTSW 7 42011823 missense probably benign 0.44
X0025:Vmn2r59 UTSW 7 42045941 missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 42012414 missense possibly damaging 0.85
Z1176:Vmn2r59 UTSW 7 42042517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGAGAGTTCATTGATCATGACATC -3'
(R):5'- AGCTGTCCTGGCTTCATGAC -3'

Sequencing Primer
(F):5'- TGTAAACCCTGTAGGCCA -3'
(R):5'- TGGAAATGGCTGTTTCAAATGAG -3'
Posted On2018-09-12