Incidental Mutation 'R6830:Tollip'
ID534351
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Nametoll interacting protein
Synonyms4930403G24Rik, Toll interacting protein, 4931428G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141874813-141918507 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 141898714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000117938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
Predicted Effect probably benign
Transcript: ENSMUST00000001950
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055819
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130439
AA Change: M1K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151890
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R4092:Tollip UTSW 7 141884443 missense probably damaging 1.00
R5192:Tollip UTSW 7 141892117 missense probably damaging 1.00
R5614:Tollip UTSW 7 141892088 missense probably damaging 1.00
R6132:Tollip UTSW 7 141889597 missense probably benign 0.37
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R7759:Tollip UTSW 7 141884539 missense probably benign
R8024:Tollip UTSW 7 141892826 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGTGGGTAGACTCCTCCTAAAC -3'
(R):5'- TAATGGAGAAGGGATTTGAGTTCC -3'

Sequencing Primer
(F):5'- GGGTAGACTCCTCCTAAACATAAATG -3'
(R):5'- AGAAGGGATTTGAGTTCCTTAGG -3'
Posted On2018-09-12