Incidental Mutation 'R6830:Ano6'
ID534364
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95894461 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 90 (R90G)
Ref Sequence ENSEMBL: ENSMUSP00000153954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000226793] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: R69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: R69G

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226793
AA Change: R55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227151
AA Change: R69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: R90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGCATTCTAGGCTACTGC -3'
(R):5'- TGTCTGGTTCACGGTACTCC -3'

Sequencing Primer
(F):5'- GGTAACTCGGTATGACTGTATCTCTC -3'
(R):5'- GGTTCACGGTACTCCACATC -3'
Posted On2018-09-12