Incidental Mutation 'R6830:Zbtb21'
ID534367
Institutional Source Beutler Lab
Gene Symbol Zbtb21
Ensembl Gene ENSMUSG00000046962
Gene Namezinc finger and BTB domain containing 21
SynonymsZfp295, B430213I24Rik, 5430437K12Rik, Znf295
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location97943357-97962622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97951961 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 402 (G402D)
Ref Sequence ENSEMBL: ENSMUSP00000109363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052089] [ENSMUST00000063605] [ENSMUST00000113734] [ENSMUST00000231263] [ENSMUST00000231560] [ENSMUST00000232165] [ENSMUST00000232187]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052089
AA Change: G402D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052127
Gene: ENSMUSG00000046962
AA Change: G402D

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 578 598 2.14e2 SMART
ZnF_C2H2 605 628 8.67e-1 SMART
low complexity region 708 728 N/A INTRINSIC
ZnF_C2H2 737 757 2.06e1 SMART
ZnF_C2H2 765 787 4.65e-1 SMART
low complexity region 804 829 N/A INTRINSIC
ZnF_C2H2 871 893 1.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063605
AA Change: G374D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068283
Gene: ENSMUSG00000046962
AA Change: G374D

DomainStartEndE-ValueType
BTB 30 126 5.14e-18 SMART
low complexity region 433 442 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
ZnF_C2H2 549 572 8.09e-1 SMART
ZnF_C2H2 578 601 2.63e0 SMART
ZnF_C2H2 673 695 3.58e-2 SMART
ZnF_C2H2 750 770 2.14e2 SMART
ZnF_C2H2 777 800 8.67e-1 SMART
low complexity region 880 900 N/A INTRINSIC
ZnF_C2H2 909 929 2.06e1 SMART
ZnF_C2H2 937 959 4.65e-1 SMART
low complexity region 976 1001 N/A INTRINSIC
ZnF_C2H2 1043 1065 1.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113734
AA Change: G402D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109363
Gene: ENSMUSG00000046962
AA Change: G402D

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 577 600 8.09e-1 SMART
ZnF_C2H2 606 629 2.63e0 SMART
ZnF_C2H2 701 723 3.58e-2 SMART
ZnF_C2H2 778 798 2.14e2 SMART
ZnF_C2H2 805 828 8.67e-1 SMART
low complexity region 908 928 N/A INTRINSIC
ZnF_C2H2 937 957 2.06e1 SMART
ZnF_C2H2 965 987 4.65e-1 SMART
low complexity region 1004 1029 N/A INTRINSIC
ZnF_C2H2 1071 1093 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231263
Predicted Effect probably benign
Transcript: ENSMUST00000231560
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect probably benign
Transcript: ENSMUST00000232187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Zbtb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Zbtb21 APN 16 97952320 missense probably benign 0.03
IGL00921:Zbtb21 APN 16 97952022 missense probably damaging 1.00
IGL01825:Zbtb21 APN 16 97952689 missense possibly damaging 0.63
IGL02310:Zbtb21 APN 16 97951790 missense possibly damaging 0.89
IGL03126:Zbtb21 APN 16 97951745 missense probably damaging 1.00
IGL03332:Zbtb21 APN 16 97952333 missense possibly damaging 0.94
R0165:Zbtb21 UTSW 16 97951404 missense probably damaging 1.00
R0184:Zbtb21 UTSW 16 97950513 missense probably damaging 1.00
R0267:Zbtb21 UTSW 16 97952100 missense probably damaging 1.00
R0734:Zbtb21 UTSW 16 97952627 missense probably damaging 1.00
R1546:Zbtb21 UTSW 16 97952027 missense probably damaging 0.97
R1565:Zbtb21 UTSW 16 97952427 missense probably benign 0.00
R1778:Zbtb21 UTSW 16 97950585 missense probably benign 0.02
R2049:Zbtb21 UTSW 16 97950155 missense probably damaging 1.00
R4086:Zbtb21 UTSW 16 97952763 missense probably damaging 1.00
R4619:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4620:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4754:Zbtb21 UTSW 16 97951266 missense probably damaging 1.00
R4785:Zbtb21 UTSW 16 97950455 missense possibly damaging 0.60
R5466:Zbtb21 UTSW 16 97950498 missense possibly damaging 0.66
R5989:Zbtb21 UTSW 16 97951499 missense probably damaging 1.00
R6374:Zbtb21 UTSW 16 97950368 missense probably damaging 0.98
R6469:Zbtb21 UTSW 16 97956772 missense probably benign 0.01
R6732:Zbtb21 UTSW 16 97951082 missense probably damaging 0.97
R7123:Zbtb21 UTSW 16 97949912 missense probably damaging 0.96
R7129:Zbtb21 UTSW 16 97951687 small deletion probably benign
R7261:Zbtb21 UTSW 16 97952979 missense possibly damaging 0.46
R7305:Zbtb21 UTSW 16 97951295 missense possibly damaging 0.92
R7372:Zbtb21 UTSW 16 97950369 missense possibly damaging 0.55
R7564:Zbtb21 UTSW 16 97951540 nonsense probably null
R7670:Zbtb21 UTSW 16 97951877 missense probably damaging 0.99
R7788:Zbtb21 UTSW 16 97951454 missense possibly damaging 0.62
X0022:Zbtb21 UTSW 16 97952075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTGAGGGGTCTGACAG -3'
(R):5'- TGCTCTACTACTCTAAGCTAGGG -3'

Sequencing Primer
(F):5'- CTGCTGGGTTCCGTCTTAATGC -3'
(R):5'- CTAGGGCTGGTGGTCCCTTC -3'
Posted On2018-09-12