Incidental Mutation 'R6830:Slc25a23'
ID534370
Institutional Source Beutler Lab
Gene Symbol Slc25a23
Ensembl Gene ENSMUSG00000046329
Gene Namesolute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57043711-57059863 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 57053804 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 9 (R9*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040280] [ENSMUST00000171528]
Predicted Effect probably null
Transcript: ENSMUST00000040280
AA Change: R207*
SMART Domains Protein: ENSMUSP00000040198
Gene: ENSMUSG00000046329
AA Change: R207*

DomainStartEndE-ValueType
EFh 13 41 2.72e-3 SMART
EFh 80 108 1.09e0 SMART
EFh 116 144 3.07e1 SMART
Pfam:Mito_carr 181 273 3.8e-25 PFAM
Pfam:Mito_carr 274 366 4.1e-26 PFAM
Pfam:Mito_carr 372 465 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163442
SMART Domains Protein: ENSMUSP00000132962
Gene: ENSMUSG00000046329

DomainStartEndE-ValueType
Pfam:Mito_carr 1 58 6.5e-15 PFAM
Pfam:Mito_carr 64 123 1.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170015
AA Change: R9*
SMART Domains Protein: ENSMUSP00000132169
Gene: ENSMUSG00000046329
AA Change: R9*

DomainStartEndE-ValueType
Pfam:Mito_carr 1 76 1.9e-19 PFAM
Pfam:Mito_carr 77 166 1.2e-21 PFAM
Pfam:Mito_carr 172 265 7.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171128
Predicted Effect probably benign
Transcript: ENSMUST00000171528
SMART Domains Protein: ENSMUSP00000128348
Gene: ENSMUSG00000046329

DomainStartEndE-ValueType
Pfam:Mito_carr 22 114 8.3e-29 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mitochondrial function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Slc25a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Slc25a23 APN 17 57047233 missense probably benign 0.01
IGL01614:Slc25a23 APN 17 57045579 missense probably null 0.98
IGL01919:Slc25a23 APN 17 57047291 missense possibly damaging 0.61
IGL01933:Slc25a23 APN 17 57052813 nonsense probably null
IGL02297:Slc25a23 APN 17 57053324 missense probably benign 0.00
R1317:Slc25a23 UTSW 17 57053888 missense possibly damaging 0.63
R1411:Slc25a23 UTSW 17 57059622 missense probably damaging 0.97
R1577:Slc25a23 UTSW 17 57047306 missense probably benign 0.00
R2156:Slc25a23 UTSW 17 57045562 missense probably benign 0.00
R4581:Slc25a23 UTSW 17 57052740 missense probably damaging 0.96
R4755:Slc25a23 UTSW 17 57052794 missense possibly damaging 0.92
R4786:Slc25a23 UTSW 17 57047326 missense possibly damaging 0.68
R4789:Slc25a23 UTSW 17 57059597 missense probably damaging 1.00
R5402:Slc25a23 UTSW 17 57053336 missense probably benign 0.07
R5423:Slc25a23 UTSW 17 57053597 missense probably damaging 0.99
R5478:Slc25a23 UTSW 17 57052780 missense probably damaging 1.00
R5659:Slc25a23 UTSW 17 57045500 unclassified probably benign
R5787:Slc25a23 UTSW 17 57053825 missense probably damaging 1.00
R6417:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6420:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6462:Slc25a23 UTSW 17 57052720 missense probably damaging 1.00
R6858:Slc25a23 UTSW 17 57058171 missense probably damaging 1.00
R7311:Slc25a23 UTSW 17 57052827 missense probably damaging 1.00
R7381:Slc25a23 UTSW 17 57053587 missense probably damaging 1.00
R7491:Slc25a23 UTSW 17 57052822 nonsense probably null
R7543:Slc25a23 UTSW 17 57058106 critical splice donor site probably null
R7646:Slc25a23 UTSW 17 57059759 unclassified probably benign
R8879:Slc25a23 UTSW 17 57059709 unclassified probably benign
X0026:Slc25a23 UTSW 17 57055350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGCTATCTTGAGCACGTTG -3'
(R):5'- CCTCTGCTGGAACATGACATCC -3'

Sequencing Primer
(F):5'- ATCTTGAGCACGTTGATGCC -3'
(R):5'- GCTGGAACATGACATCCACAGC -3'
Posted On2018-09-12