Incidental Mutation 'R6835:Fam133b'
ID534384
Institutional Source Beutler Lab
Gene Symbol Fam133b
Ensembl Gene ENSMUSG00000058503
Gene Namefamily with sequence similarity 133, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location3543833-3570238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3554732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000142744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115527] [ENSMUST00000197082] [ENSMUST00000199666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115527
AA Change: T40A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111189
Gene: ENSMUSG00000058503
AA Change: T40A

DomainStartEndE-ValueType
coiled coil region 40 82 N/A INTRINSIC
low complexity region 85 141 N/A INTRINSIC
low complexity region 145 166 N/A INTRINSIC
low complexity region 218 244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197082
AA Change: T40A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142744
Gene: ENSMUSG00000058503
AA Change: T40A

DomainStartEndE-ValueType
coiled coil region 40 82 N/A INTRINSIC
low complexity region 85 158 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199666
AA Change: T40A

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143004
Gene: ENSMUSG00000058503
AA Change: T40A

DomainStartEndE-ValueType
coiled coil region 40 82 N/A INTRINSIC
low complexity region 86 109 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Fam133b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Fam133b APN 5 3564242 splice site probably benign
IGL03026:Fam133b APN 5 3559646 utr 3 prime probably benign
IGL03218:Fam133b APN 5 3554684 nonsense probably null
R0433:Fam133b UTSW 5 3558560 splice site probably benign
R1299:Fam133b UTSW 5 3554626 splice site probably benign
R3176:Fam133b UTSW 5 3558522 missense probably damaging 1.00
R3276:Fam133b UTSW 5 3558522 missense probably damaging 1.00
R3705:Fam133b UTSW 5 3561034 splice site probably benign
R4722:Fam133b UTSW 5 3543949 critical splice donor site probably null
R4799:Fam133b UTSW 5 3557815 missense probably damaging 0.99
R6151:Fam133b UTSW 5 3559133 missense probably null
R6709:Fam133b UTSW 5 3569059 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CATTCAGGGCTTTGTAGGTTAC -3'
(R):5'- ATAGGGTGCACATGGGTCTAAC -3'

Sequencing Primer
(F):5'- GGTTACATTGGCTTTGTAATAACTTG -3'
(R):5'- TGCACATGGGTCTAACAAGATTAAAG -3'
Posted On2018-09-12