Incidental Mutation 'R6835:Edem1'
ID534388
Institutional Source Beutler Lab
Gene Symbol Edem1
Ensembl Gene ENSMUSG00000030104
Gene NameER degradation enhancer, mannosidase alpha-like 1
SynonymsA130059K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location108828641-108859356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108854399 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 607 (V607A)
Ref Sequence ENSEMBL: ENSMUSP00000086565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089162] [ENSMUST00000204804]
Predicted Effect probably benign
Transcript: ENSMUST00000089162
AA Change: V607A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000086565
Gene: ENSMUSG00000030104
AA Change: V607A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 581 1.1e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204804
SMART Domains Protein: ENSMUSP00000144901
Gene: ENSMUSG00000030104

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 529 9.9e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Edem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Edem1 APN 6 108855559 utr 3 prime probably benign
IGL00648:Edem1 APN 6 108851207 splice site probably null
IGL00694:Edem1 APN 6 108841601 missense possibly damaging 0.95
IGL02231:Edem1 APN 6 108828888 missense probably benign 0.06
IGL02967:Edem1 APN 6 108836777 missense probably damaging 1.00
IGL03018:Edem1 APN 6 108829142 missense probably damaging 0.98
PIT4468001:Edem1 UTSW 6 108844867 missense probably damaging 0.98
R0050:Edem1 UTSW 6 108828848 missense possibly damaging 0.91
R0367:Edem1 UTSW 6 108846752 missense probably damaging 1.00
R1165:Edem1 UTSW 6 108851253 missense probably damaging 1.00
R1354:Edem1 UTSW 6 108854316 missense possibly damaging 0.93
R1385:Edem1 UTSW 6 108846684 missense probably damaging 1.00
R1588:Edem1 UTSW 6 108841679 missense probably damaging 1.00
R1964:Edem1 UTSW 6 108844947 missense probably benign 0.03
R2060:Edem1 UTSW 6 108854287 missense probably damaging 0.99
R2106:Edem1 UTSW 6 108848725 missense probably damaging 0.98
R2393:Edem1 UTSW 6 108852543 missense probably damaging 1.00
R2443:Edem1 UTSW 6 108851269 missense probably benign 0.13
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3733:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3734:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R4754:Edem1 UTSW 6 108841697 missense probably damaging 1.00
R4791:Edem1 UTSW 6 108841634 missense probably damaging 1.00
R4792:Edem1 UTSW 6 108828746 unclassified probably benign
R5326:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5334:Edem1 UTSW 6 108848832 critical splice donor site probably null
R5501:Edem1 UTSW 6 108843100 critical splice donor site probably null
R5542:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5976:Edem1 UTSW 6 108842962 missense probably damaging 0.99
R6177:Edem1 UTSW 6 108851198 splice site probably null
R6556:Edem1 UTSW 6 108854357 missense probably benign 0.00
R7192:Edem1 UTSW 6 108829004 missense probably benign 0.00
R7239:Edem1 UTSW 6 108854380 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAGTAGAGCTGTATGCCAG -3'
(R):5'- CTGATGTGCCTATACTGCTGC -3'

Sequencing Primer
(F):5'- TTCATGCAGTGGCTAGCCTAGAAC -3'
(R):5'- CATCCTAGTGGCACTTTGTAAATGG -3'
Posted On2018-09-12