Incidental Mutation 'R6835:Cfap46'
ID534396
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139652498 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 850 (I850F)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
Predicted Effect probably damaging
Transcript: ENSMUST00000129990
AA Change: I850F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: I850F

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATAGTCCCTTCCCAGCAACTG -3'
(R):5'- ATGGTCCACTGGAGTCTTCG -3'

Sequencing Primer
(F):5'- GCAACTGCGGTCATATCTAAGAC -3'
(R):5'- CTCTATCAGATATCAGAGCAGCTGTG -3'
Posted On2018-09-12