Incidental Mutation 'R6835:Icam1'
ID534398
Institutional Source Beutler Lab
Gene Symbol Icam1
Ensembl Gene ENSMUSG00000037405
Gene Nameintercellular adhesion molecule 1
SynonymsCD54, Icam-1, Ly-47, MALA-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21015985-21028817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 21027125 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 327 (G327W)
Ref Sequence ENSEMBL: ENSMUSP00000083587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001040] [ENSMUST00000019616] [ENSMUST00000086399] [ENSMUST00000215077]
Predicted Effect probably benign
Transcript: ENSMUST00000001040
SMART Domains Protein: ENSMUSP00000001040
Gene: ENSMUSG00000001014

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ICAM_N 37 128 2.5e-17 PFAM
Blast:IG_like 133 224 1e-9 BLAST
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019616
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086399
AA Change: G327W

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083587
Gene: ENSMUSG00000037405
AA Change: G327W

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
IG_like 33 109 5.91e1 SMART
IG_like 119 208 1.15e2 SMART
IG 319 396 1.49e-2 SMART
IG 407 479 3.91e-6 SMART
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215077
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that binds leukocyte adhesion protein LFA-1. It participates in the innate immune response. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired inflammatory and immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Icam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Icam1 APN 9 21016105 splice site probably null
IGL01652:Icam1 APN 9 21019176 missense probably damaging 1.00
R0458:Icam1 UTSW 9 21027861 unclassified probably null
R0709:Icam1 UTSW 9 21019127 missense probably damaging 0.98
R1102:Icam1 UTSW 9 21027836 missense possibly damaging 0.83
R1473:Icam1 UTSW 9 21027876 missense probably damaging 1.00
R2210:Icam1 UTSW 9 21019033 missense probably damaging 1.00
R4362:Icam1 UTSW 9 21026312 missense possibly damaging 0.62
R5350:Icam1 UTSW 9 21027886 nonsense probably null
R7296:Icam1 UTSW 9 21019015 missense probably benign 0.00
R7381:Icam1 UTSW 9 21027590 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGCTAGGCCCAGTTC -3'
(R):5'- TATCACTCAGCACTGCAGC -3'

Sequencing Primer
(F):5'- CCATCTTGTACTTGAGGC -3'
(R):5'- CCAGGGTCTGGTTTTTAAACAGGAAC -3'
Posted On2018-09-12