Incidental Mutation 'R6835:Etfa'
ID534399
Institutional Source Beutler Lab
Gene Symbol Etfa
Ensembl Gene ENSMUSG00000032314
Gene Nameelectron transferring flavoprotein, alpha polypeptide
Synonyms2010200I21Rik, D9Ertd394e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location55454508-55512243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55495819 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 64 (V64A)
Ref Sequence ENSEMBL: ENSMUSP00000034866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034866]
Predicted Effect probably benign
Transcript: ENSMUST00000034866
AA Change: V64A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034866
Gene: ENSMUSG00000032314
AA Change: V64A

DomainStartEndE-ValueType
ETF 22 203 4.71e-48 SMART
Pfam:ETF_alpha 210 293 6.4e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ETFA participates in catalyzing the initial step of the mitochondrial fatty acid beta-oxidation. It shuttles electrons between primary flavoprotein dehydrogenases and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. Defects in electron-transfer-flavoprotein have been implicated in type II glutaricaciduria in which multiple acyl-CoA dehydrogenase deficiencies result in large excretion of glutaric, lactic, ethylmalonic, butyric, isobutyric, 2-methyl-butyric, and isovaleric acids. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Etfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02214:Etfa APN 9 55464811 missense probably damaging 1.00
IGL02471:Etfa APN 9 55486700 critical splice donor site probably null
IGL03068:Etfa APN 9 55487482 missense probably benign
R0944:Etfa UTSW 9 55488838 missense probably damaging 1.00
R2267:Etfa UTSW 9 55486731 missense probably damaging 1.00
R2913:Etfa UTSW 9 55482329 missense probably damaging 1.00
R4528:Etfa UTSW 9 55500050 missense probably damaging 1.00
R4769:Etfa UTSW 9 55495767 missense possibly damaging 0.57
R5055:Etfa UTSW 9 55500133 missense probably damaging 1.00
R5089:Etfa UTSW 9 55488866 nonsense probably null
R5402:Etfa UTSW 9 55454739 missense probably benign
R6141:Etfa UTSW 9 55464819 missense probably damaging 1.00
R6363:Etfa UTSW 9 55500133 missense probably damaging 1.00
R6574:Etfa UTSW 9 55495626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAATCAATGGTGTGAGTTCC -3'
(R):5'- TCTGACTCTCAAGTGCTGGG -3'

Sequencing Primer
(F):5'- GGTGTGAGTTCCTCTGAGAATTAAAC -3'
(R):5'- CTGACTCTCAAGTGCTGGGATTAAAG -3'
Posted On2018-09-12