Incidental Mutation 'R6835:Nt5dc1'
ID534403
Institutional Source Beutler Lab
Gene Symbol Nt5dc1
Ensembl Gene ENSMUSG00000039480
Gene Name5'-nucleotidase domain containing 1
SynonymsNt5c2l1, 6030401B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location34288288-34418552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34310379 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 398 (S398A)
Ref Sequence ENSEMBL: ENSMUSP00000101151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000105512]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
AA Change: S399A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480
AA Change: S399A

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105512
AA Change: S398A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480
AA Change: S398A

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Nt5dc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Nt5dc1 APN 10 34407557 missense possibly damaging 0.80
IGL02096:Nt5dc1 APN 10 34399810 nonsense probably null
IGL02471:Nt5dc1 APN 10 34403725 missense probably benign 0.03
IGL03345:Nt5dc1 APN 10 34324462 missense probably benign 0.04
R0083:Nt5dc1 UTSW 10 34403764 missense probably damaging 0.98
R1159:Nt5dc1 UTSW 10 34398173 missense possibly damaging 0.93
R1898:Nt5dc1 UTSW 10 34313635 missense probably benign 0.00
R1901:Nt5dc1 UTSW 10 34313671 missense probably damaging 1.00
R2327:Nt5dc1 UTSW 10 34313677 missense possibly damaging 0.66
R4365:Nt5dc1 UTSW 10 34310381 missense probably benign 0.20
R4942:Nt5dc1 UTSW 10 34322677 missense probably damaging 1.00
R4943:Nt5dc1 UTSW 10 34310391 missense probably damaging 1.00
R5168:Nt5dc1 UTSW 10 34397240 missense probably benign 0.05
R5507:Nt5dc1 UTSW 10 34397230 missense probably benign
R5605:Nt5dc1 UTSW 10 34403695 missense probably benign 0.12
R6406:Nt5dc1 UTSW 10 34324408 missense probably benign 0.04
R6495:Nt5dc1 UTSW 10 34324369 missense probably damaging 1.00
R6799:Nt5dc1 UTSW 10 34313707 missense possibly damaging 0.79
R7480:Nt5dc1 UTSW 10 34324453 missense probably damaging 1.00
R7480:Nt5dc1 UTSW 10 34324454 missense probably damaging 1.00
R7486:Nt5dc1 UTSW 10 34399809 missense probably benign 0.26
R7493:Nt5dc1 UTSW 10 34304936 missense probably benign 0.00
R7638:Nt5dc1 UTSW 10 34314796 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTAAGAAGACCGCTCCTTTTG -3'
(R):5'- TGGGTCATGTTAAAGTGCACTCATAG -3'

Sequencing Primer
(F):5'- GAAGACCGCTCCTTTTGAAGAC -3'
(R):5'- TGTTAAAGTGCACTCATAGTAAGGAG -3'
Posted On2018-09-12