Incidental Mutation 'R6835:Pcdhgb1'
ID534417
Institutional Source Beutler Lab
Gene Symbol Pcdhgb1
Ensembl Gene ENSMUSG00000103037
Gene Nameprotocadherin gamma subfamily B, 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37680233-37841870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37680500 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 15 (C15S)
Ref Sequence ENSEMBL: ENSMUSP00000141348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
AA Change: C15S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037
AA Change: C15S

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Pcdhgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT1430001:Pcdhgb1 UTSW 18 37681419 missense probably damaging 1.00
R4433:Pcdhgb1 UTSW 18 37681251 missense probably damaging 0.99
R4599:Pcdhgb1 UTSW 18 37681557 missense probably damaging 1.00
R4974:Pcdhgb1 UTSW 18 37682372 missense probably benign 0.11
R5214:Pcdhgb1 UTSW 18 37681425 missense probably damaging 1.00
R5621:Pcdhgb1 UTSW 18 37682169 missense possibly damaging 0.90
R5981:Pcdhgb1 UTSW 18 37681854 missense probably damaging 1.00
R6593:Pcdhgb1 UTSW 18 37682081 missense probably damaging 1.00
R6666:Pcdhgb1 UTSW 18 37681493 nonsense probably null
R6992:Pcdhgb1 UTSW 18 37681599 missense probably benign 0.03
R7152:Pcdhgb1 UTSW 18 37681801 missense probably benign 0.38
R7512:Pcdhgb1 UTSW 18 37682365 missense probably damaging 1.00
R7583:Pcdhgb1 UTSW 18 37682324 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGAACATCCGTCCGGTTC -3'
(R):5'- AGTGCACACTCAGATTTCCTCC -3'

Sequencing Primer
(F):5'- AACATCCGTCCGGTTCCTGTG -3'
(R):5'- TATCCTGCCGCTCACTAACAAATC -3'
Posted On2018-09-12