Incidental Mutation 'R6835:Taf5'
ID534418
Institutional Source Beutler Lab
Gene Symbol Taf5
Ensembl Gene ENSMUSG00000025049
Gene NameTATA-box binding protein associated factor 5
Synonyms6330528C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47067748-47083479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47077337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 494 (T494A)
Ref Sequence ENSEMBL: ENSMUSP00000026027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026027
AA Change: T494A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026027
Gene: ENSMUSG00000025049
AA Change: T494A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 29 92 N/A INTRINSIC
LisH 93 125 6.52e-2 SMART
low complexity region 132 150 N/A INTRINSIC
Pfam:TFIID_NTD2 206 338 4.5e-55 PFAM
low complexity region 389 417 N/A INTRINSIC
WD40 460 499 8.36e-2 SMART
WD40 533 572 1.82e-11 SMART
WD40 575 614 1.19e-6 SMART
WD40 617 656 9.08e-12 SMART
WD40 659 698 1.4e-12 SMART
WD40 701 740 2.57e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Taf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Taf5 APN 19 47082301 missense probably damaging 1.00
IGL01115:Taf5 APN 19 47075082 missense probably benign 0.01
IGL02168:Taf5 APN 19 47082478 missense probably damaging 0.98
IGL02638:Taf5 APN 19 47068210 missense probably benign 0.00
IGL02689:Taf5 APN 19 47077265 splice site probably benign
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0220:Taf5 UTSW 19 47080560 missense probably damaging 1.00
R0685:Taf5 UTSW 19 47074854 missense probably benign 0.10
R1518:Taf5 UTSW 19 47081846 missense probably damaging 1.00
R2329:Taf5 UTSW 19 47075124 missense probably benign 0.07
R3431:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3432:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3689:Taf5 UTSW 19 47078785 missense probably damaging 0.99
R4411:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4413:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4676:Taf5 UTSW 19 47074970 missense probably damaging 1.00
R5370:Taf5 UTSW 19 47075764 missense probably damaging 0.99
R5875:Taf5 UTSW 19 47076110 missense probably damaging 1.00
R5883:Taf5 UTSW 19 47067789 missense unknown
R5937:Taf5 UTSW 19 47081895 missense probably damaging 1.00
R7007:Taf5 UTSW 19 47071211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATGTGTTCAGAGTTGTCAAATG -3'
(R):5'- TGTAACCCCGGAATTCAAGAG -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACCAGGTTG -3'
(R):5'- CCGGAATTCAAGAGAAATCACTTCTG -3'
Posted On2018-09-12