Incidental Mutation 'R6833:Mybpc3'
ID534430
Institutional Source Beutler Lab
Gene Symbol Mybpc3
Ensembl Gene ENSMUSG00000002100
Gene Namemyosin binding protein C, cardiac
Synonymscardiac C-protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91118144-91136516 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 91125428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111430] [ENSMUST00000137942] [ENSMUST00000169776]
Predicted Effect probably null
Transcript: ENSMUST00000111430
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137942
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169776
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null or truncated mutations exhibit cardiac abnormalities such as cardiac hypertrophy, dilated cardiomyopathy, abnormal cardiac muscle contractility and relaxation, disorganized myocardium, and cardiac fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Mybpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mybpc3 APN 2 91120029 missense probably benign
IGL00985:Mybpc3 APN 2 91135359 missense probably benign 0.16
IGL01926:Mybpc3 APN 2 91135407 missense possibly damaging 0.61
IGL02135:Mybpc3 APN 2 91124826 missense possibly damaging 0.58
IGL02187:Mybpc3 APN 2 91135452 missense probably benign
IGL02219:Mybpc3 APN 2 91121023 critical splice acceptor site probably null
IGL02752:Mybpc3 APN 2 91132637 critical splice acceptor site probably null
IGL03002:Mybpc3 APN 2 91123889 missense probably damaging 1.00
IGL03118:Mybpc3 APN 2 91124503 missense probably damaging 1.00
IGL03238:Mybpc3 APN 2 91131659 missense probably damaging 1.00
R0010:Mybpc3 UTSW 2 91134833 nonsense probably null
R0114:Mybpc3 UTSW 2 91124494 missense probably damaging 1.00
R0139:Mybpc3 UTSW 2 91120337 splice site probably benign
R0282:Mybpc3 UTSW 2 91124024 splice site probably benign
R0673:Mybpc3 UTSW 2 91120427 missense probably damaging 1.00
R1388:Mybpc3 UTSW 2 91122874 missense probably benign 0.43
R2159:Mybpc3 UTSW 2 91125370 missense probably damaging 1.00
R2424:Mybpc3 UTSW 2 91135793 missense probably benign 0.20
R3983:Mybpc3 UTSW 2 91135369 missense probably benign
R4322:Mybpc3 UTSW 2 91123961 missense possibly damaging 0.87
R4909:Mybpc3 UTSW 2 91134812 missense probably benign
R4913:Mybpc3 UTSW 2 91126264 missense possibly damaging 0.46
R4965:Mybpc3 UTSW 2 91119247 missense possibly damaging 0.50
R5248:Mybpc3 UTSW 2 91125228 intron probably null
R5311:Mybpc3 UTSW 2 91128678 nonsense probably null
R5332:Mybpc3 UTSW 2 91122938 missense probably damaging 1.00
R5635:Mybpc3 UTSW 2 91134829 missense probably benign 0.00
R5647:Mybpc3 UTSW 2 91121722 splice site probably null
R5698:Mybpc3 UTSW 2 91124849 missense possibly damaging 0.85
R5832:Mybpc3 UTSW 2 91119175 splice site probably null
R5895:Mybpc3 UTSW 2 91124665 missense probably damaging 0.99
R7061:Mybpc3 UTSW 2 91125404 missense possibly damaging 0.93
R7144:Mybpc3 UTSW 2 91134604 missense probably benign 0.03
R7169:Mybpc3 UTSW 2 91118179 missense possibly damaging 0.85
R7472:Mybpc3 UTSW 2 91131656 missense probably damaging 1.00
R7538:Mybpc3 UTSW 2 91120487 missense probably damaging 1.00
R7677:Mybpc3 UTSW 2 91129031 missense probably benign 0.04
Z1088:Mybpc3 UTSW 2 91135359 missense probably benign 0.16
Z1176:Mybpc3 UTSW 2 91120403 missense not run
Z1177:Mybpc3 UTSW 2 91123964 missense not run
Predicted Primers PCR Primer
(F):5'- GTCCCGTAACTGCACATACC -3'
(R):5'- TACTGCCACTGCCCAGTTTG -3'

Sequencing Primer
(F):5'- AGAGGCCTGCATACCACTG -3'
(R):5'- CCAGTTTGGGGAATGGCAG -3'
Posted On2018-09-12