Incidental Mutation 'R6833:Stard9'
ID 534431
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name StAR related lipid transfer domain containing 9
Synonyms 4831403C07Rik, E230025N21Rik, Kif16a, N-3 kinesin
MMRRC Submission 044942-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R6833 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120459602-120562376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 120531740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 2666 (V2666F)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: V2666F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: V2666F

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,658,733 (GRCm39) W215R probably damaging Het
Aco1 A G 4: 40,164,747 (GRCm39) K79R probably benign Het
Adam28 C T 14: 68,855,576 (GRCm39) A630T probably benign Het
Alpk2 T C 18: 65,439,480 (GRCm39) K1105E probably benign Het
Angptl1 A T 1: 156,672,263 (GRCm39) I30L probably benign Het
Astn1 A T 1: 158,491,692 (GRCm39) Q47L probably benign Het
Atf6b T C 17: 34,868,131 (GRCm39) S135P probably damaging Het
Ccdc122 G T 14: 77,326,371 (GRCm39) probably benign Het
Cers3 T C 7: 66,429,419 (GRCm39) probably null Het
Dcaf10 T C 4: 45,373,043 (GRCm39) C95R probably damaging Het
Dcxr A G 11: 120,616,917 (GRCm39) Y149H probably damaging Het
Dmxl1 A T 18: 50,088,890 (GRCm39) I2790F probably damaging Het
Dnhd1 T A 7: 105,352,580 (GRCm39) C2578S probably benign Het
Dnttip2 T C 3: 122,070,452 (GRCm39) S556P probably damaging Het
Efr3a T G 15: 65,714,535 (GRCm39) V301G probably damaging Het
Eml5 A T 12: 98,853,283 (GRCm39) H105Q probably damaging Het
Enpp3 T A 10: 24,685,768 (GRCm39) H44L probably damaging Het
Fam120a A G 13: 49,087,517 (GRCm39) V281A probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Ferd3l G A 12: 33,978,537 (GRCm39) V17I probably damaging Het
Glb1l A G 1: 75,178,397 (GRCm39) V347A possibly damaging Het
Gm4846 A T 1: 166,322,147 (GRCm39) I140N possibly damaging Het
Gm9195 T C 14: 72,671,856 (GRCm39) T2586A possibly damaging Het
Hsd17b8 T C 17: 34,246,191 (GRCm39) S161G probably damaging Het
Hsp90ab1 T C 17: 45,881,393 (GRCm39) I250V probably benign Het
Il11ra1 A G 4: 41,765,454 (GRCm39) H183R probably benign Het
Lama3 G A 18: 12,624,605 (GRCm39) C1450Y probably damaging Het
Lgals7 G A 7: 28,565,087 (GRCm39) R75Q probably damaging Het
Lpcat3 A G 6: 124,676,974 (GRCm39) Y124C probably damaging Het
Lrrc8a T A 2: 30,145,659 (GRCm39) S158T possibly damaging Het
Mcm3 A T 1: 20,880,320 (GRCm39) M504K possibly damaging Het
Mro G T 18: 73,997,003 (GRCm39) probably benign Het
Mybpc3 A G 2: 90,955,773 (GRCm39) probably null Het
Myh14 T A 7: 44,273,803 (GRCm39) K1356* probably null Het
Myo5b A C 18: 74,903,396 (GRCm39) Q1804P probably benign Het
Nol10 A G 12: 17,402,728 (GRCm39) I67V probably benign Het
Pam T A 1: 97,765,717 (GRCm39) I771F probably damaging Het
Pcdhgb8 G T 18: 37,895,142 (GRCm39) A71S probably benign Het
Pmfbp1 T C 8: 110,265,307 (GRCm39) probably null Het
Poc1b C T 10: 99,028,666 (GRCm39) A336V probably benign Het
Poglut3 A G 9: 53,303,308 (GRCm39) I67V possibly damaging Het
Prap1 C A 7: 139,674,995 (GRCm39) A20E possibly damaging Het
Prox1 G A 1: 189,892,975 (GRCm39) A490V probably damaging Het
Prss39 G T 1: 34,537,697 (GRCm39) V54F possibly damaging Het
Sema3b T A 9: 107,480,515 (GRCm39) E144V probably benign Het
Sft2d1 C T 17: 8,537,707 (GRCm39) T32I possibly damaging Het
Smpd2 C T 10: 41,364,442 (GRCm39) A160T probably damaging Het
Syt7 T A 19: 10,421,508 (GRCm39) M400K probably damaging Het
Thoc5 T C 11: 4,869,804 (GRCm39) L402P probably damaging Het
Tinf2 A T 14: 55,919,037 (GRCm39) M1K probably null Het
Ttc21a A G 9: 119,771,701 (GRCm39) I167V probably benign Het
Vldlr T C 19: 27,217,974 (GRCm39) L474P probably damaging Het
Xirp2 T C 2: 67,340,294 (GRCm39) V845A probably benign Het
Zdhhc7 A T 8: 120,811,663 (GRCm39) M180K probably damaging Het
Zfp735 G A 11: 73,601,434 (GRCm39) G126D probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120,532,328 (GRCm39) missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120,528,960 (GRCm39) missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120,529,200 (GRCm39) missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120,531,849 (GRCm39) missense probably benign 0.04
IGL01394:Stard9 APN 2 120,536,808 (GRCm39) missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120,504,085 (GRCm39) missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120,533,811 (GRCm39) missense probably damaging 1.00
IGL01810:Stard9 APN 2 120,529,565 (GRCm39) missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120,536,927 (GRCm39) missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120,498,497 (GRCm39) missense probably damaging 1.00
IGL02031:Stard9 APN 2 120,532,820 (GRCm39) missense probably benign 0.27
IGL02081:Stard9 APN 2 120,495,391 (GRCm39) missense probably damaging 0.98
IGL02558:Stard9 APN 2 120,527,388 (GRCm39) missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120,529,473 (GRCm39) missense probably damaging 1.00
IGL02873:Stard9 APN 2 120,544,288 (GRCm39) missense probably damaging 1.00
IGL03195:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
IGL03204:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120,526,566 (GRCm39) small insertion probably benign
IGL03014:Stard9 UTSW 2 120,532,675 (GRCm39) unclassified probably benign
PIT4151001:Stard9 UTSW 2 120,533,237 (GRCm39) nonsense probably null
PIT4498001:Stard9 UTSW 2 120,527,916 (GRCm39) missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0038:Stard9 UTSW 2 120,526,313 (GRCm39) missense probably benign
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0116:Stard9 UTSW 2 120,464,736 (GRCm39) missense probably damaging 0.99
R0398:Stard9 UTSW 2 120,526,788 (GRCm39) missense probably benign 0.03
R0479:Stard9 UTSW 2 120,528,077 (GRCm39) missense probably damaging 1.00
R0556:Stard9 UTSW 2 120,529,404 (GRCm39) missense probably benign 0.09
R0589:Stard9 UTSW 2 120,529,028 (GRCm39) missense probably benign 0.00
R0609:Stard9 UTSW 2 120,536,787 (GRCm39) missense probably damaging 1.00
R0611:Stard9 UTSW 2 120,529,738 (GRCm39) missense probably benign 0.00
R0683:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0751:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign 0.04
R0833:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120,531,323 (GRCm39) missense probably damaging 1.00
R0848:Stard9 UTSW 2 120,526,304 (GRCm39) missense probably damaging 1.00
R0849:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0961:Stard9 UTSW 2 120,523,920 (GRCm39) missense probably benign 0.01
R0993:Stard9 UTSW 2 120,535,650 (GRCm39) missense probably damaging 1.00
R1005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1006:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1115:Stard9 UTSW 2 120,523,331 (GRCm39) missense probably benign 0.05
R1163:Stard9 UTSW 2 120,526,694 (GRCm39) missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1200:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1331:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1332:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1333:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1334:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1335:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1336:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1338:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1346:Stard9 UTSW 2 120,543,929 (GRCm39) missense probably damaging 1.00
R1370:Stard9 UTSW 2 120,527,958 (GRCm39) missense probably benign 0.11
R1384:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1401:Stard9 UTSW 2 120,543,328 (GRCm39) splice site probably benign
R1416:Stard9 UTSW 2 120,531,453 (GRCm39) missense probably benign 0.00
R1453:Stard9 UTSW 2 120,496,857 (GRCm39) missense probably damaging 1.00
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120,532,533 (GRCm39) missense probably benign 0.09
R1538:Stard9 UTSW 2 120,527,192 (GRCm39) missense probably benign 0.25
R1614:Stard9 UTSW 2 120,528,156 (GRCm39) missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120,534,203 (GRCm39) missense probably benign 0.37
R1658:Stard9 UTSW 2 120,532,023 (GRCm39) missense probably benign 0.02
R1686:Stard9 UTSW 2 120,529,973 (GRCm39) missense probably benign 0.00
R1797:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1803:Stard9 UTSW 2 120,531,970 (GRCm39) missense probably benign 0.24
R1806:Stard9 UTSW 2 120,509,934 (GRCm39) splice site probably null
R1847:Stard9 UTSW 2 120,528,970 (GRCm39) missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120,519,232 (GRCm39) missense probably damaging 1.00
R1892:Stard9 UTSW 2 120,524,189 (GRCm39) missense probably benign 0.01
R1906:Stard9 UTSW 2 120,526,908 (GRCm39) missense probably benign 0.00
R1907:Stard9 UTSW 2 120,544,293 (GRCm39) missense probably damaging 1.00
R1930:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1933:Stard9 UTSW 2 120,529,137 (GRCm39) missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120,531,887 (GRCm39) missense probably benign
R1999:Stard9 UTSW 2 120,523,349 (GRCm39) missense probably damaging 0.99
R2004:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,495,426 (GRCm39) missense possibly damaging 0.90
R2021:Stard9 UTSW 2 120,534,716 (GRCm39) missense probably benign 0.05
R2025:Stard9 UTSW 2 120,532,879 (GRCm39) missense probably benign 0.20
R2190:Stard9 UTSW 2 120,544,601 (GRCm39) missense probably benign 0.22
R2204:Stard9 UTSW 2 120,529,012 (GRCm39) frame shift probably null
R2422:Stard9 UTSW 2 120,530,765 (GRCm39) missense probably benign 0.29
R3401:Stard9 UTSW 2 120,534,170 (GRCm39) missense probably damaging 0.98
R3618:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120,544,030 (GRCm39) missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120,528,710 (GRCm39) missense probably benign 0.11
R4022:Stard9 UTSW 2 120,534,636 (GRCm39) missense probably benign 0.05
R4223:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120,532,427 (GRCm39) missense probably benign 0.43
R4382:Stard9 UTSW 2 120,464,703 (GRCm39) missense probably damaging 1.00
R4453:Stard9 UTSW 2 120,528,272 (GRCm39) missense probably benign
R4499:Stard9 UTSW 2 120,530,722 (GRCm39) missense probably benign 0.05
R4524:Stard9 UTSW 2 120,526,926 (GRCm39) missense probably damaging 1.00
R4671:Stard9 UTSW 2 120,529,121 (GRCm39) missense probably damaging 0.98
R4701:Stard9 UTSW 2 120,536,194 (GRCm39) missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120,526,604 (GRCm39) missense probably benign 0.01
R4822:Stard9 UTSW 2 120,526,422 (GRCm39) missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120,533,594 (GRCm39) missense probably benign 0.18
R4863:Stard9 UTSW 2 120,531,341 (GRCm39) missense probably benign 0.00
R4898:Stard9 UTSW 2 120,536,900 (GRCm39) nonsense probably null
R5033:Stard9 UTSW 2 120,523,880 (GRCm39) missense probably benign 0.00
R5087:Stard9 UTSW 2 120,527,500 (GRCm39) nonsense probably null
R5157:Stard9 UTSW 2 120,528,342 (GRCm39) missense probably benign
R5213:Stard9 UTSW 2 120,529,707 (GRCm39) missense probably damaging 1.00
R5237:Stard9 UTSW 2 120,529,839 (GRCm39) missense probably damaging 0.96
R5257:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5258:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5273:Stard9 UTSW 2 120,535,568 (GRCm39) missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120,532,428 (GRCm39) missense probably benign 0.43
R5288:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5292:Stard9 UTSW 2 120,529,626 (GRCm39) missense probably benign 0.17
R5328:Stard9 UTSW 2 120,529,711 (GRCm39) missense probably damaging 1.00
R5385:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5386:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5393:Stard9 UTSW 2 120,533,387 (GRCm39) missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120,524,149 (GRCm39) missense probably benign 0.17
R5685:Stard9 UTSW 2 120,535,803 (GRCm39) missense probably damaging 1.00
R5749:Stard9 UTSW 2 120,534,267 (GRCm39) missense probably damaging 1.00
R5780:Stard9 UTSW 2 120,533,877 (GRCm39) missense probably benign 0.02
R5901:Stard9 UTSW 2 120,531,851 (GRCm39) missense probably damaging 1.00
R5941:Stard9 UTSW 2 120,544,039 (GRCm39) missense probably damaging 1.00
R5960:Stard9 UTSW 2 120,530,442 (GRCm39) missense probably benign 0.05
R5966:Stard9 UTSW 2 120,527,580 (GRCm39) missense probably damaging 1.00
R5967:Stard9 UTSW 2 120,537,375 (GRCm39) missense probably damaging 0.99
R6012:Stard9 UTSW 2 120,535,067 (GRCm39) missense probably damaging 1.00
R6019:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6020:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6090:Stard9 UTSW 2 120,524,135 (GRCm39) missense probably damaging 0.99
R6192:Stard9 UTSW 2 120,527,241 (GRCm39) missense probably damaging 0.99
R6228:Stard9 UTSW 2 120,544,231 (GRCm39) missense probably damaging 1.00
R6235:Stard9 UTSW 2 120,544,027 (GRCm39) missense probably damaging 1.00
R6280:Stard9 UTSW 2 120,531,608 (GRCm39) missense probably benign
R6338:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign
R6344:Stard9 UTSW 2 120,534,801 (GRCm39) missense probably benign 0.12
R6364:Stard9 UTSW 2 120,543,910 (GRCm39) missense probably damaging 1.00
R6383:Stard9 UTSW 2 120,496,888 (GRCm39) critical splice donor site probably null
R6644:Stard9 UTSW 2 120,526,253 (GRCm39) missense probably benign 0.11
R6747:Stard9 UTSW 2 120,528,864 (GRCm39) missense possibly damaging 0.62
R6836:Stard9 UTSW 2 120,530,324 (GRCm39) missense probably benign 0.15
R6861:Stard9 UTSW 2 120,535,667 (GRCm39) missense probably benign 0.09
R6872:Stard9 UTSW 2 120,544,549 (GRCm39) nonsense probably null
R6875:Stard9 UTSW 2 120,527,917 (GRCm39) missense probably benign 0.04
R6915:Stard9 UTSW 2 120,533,111 (GRCm39) missense probably benign 0.00
R6934:Stard9 UTSW 2 120,528,176 (GRCm39) missense probably benign 0.00
R6943:Stard9 UTSW 2 120,532,677 (GRCm39) missense probably benign 0.29
R7009:Stard9 UTSW 2 120,527,672 (GRCm39) missense probably benign 0.37
R7031:Stard9 UTSW 2 120,530,931 (GRCm39) missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120,509,859 (GRCm39) nonsense probably null
R7151:Stard9 UTSW 2 120,526,623 (GRCm39) missense probably benign
R7154:Stard9 UTSW 2 120,535,023 (GRCm39) missense probably benign 0.02
R7154:Stard9 UTSW 2 120,531,795 (GRCm39) missense probably benign 0.00
R7165:Stard9 UTSW 2 120,534,639 (GRCm39) missense probably damaging 1.00
R7260:Stard9 UTSW 2 120,537,419 (GRCm39) missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120,464,755 (GRCm39) nonsense probably null
R7282:Stard9 UTSW 2 120,528,984 (GRCm39) missense probably benign 0.00
R7344:Stard9 UTSW 2 120,535,167 (GRCm39) missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120,497,015 (GRCm39) missense probably benign
R7359:Stard9 UTSW 2 120,528,761 (GRCm39) missense probably damaging 1.00
R7375:Stard9 UTSW 2 120,495,483 (GRCm39) splice site probably null
R7410:Stard9 UTSW 2 120,531,978 (GRCm39) missense probably benign 0.41
R7422:Stard9 UTSW 2 120,532,633 (GRCm39) missense probably benign 0.21
R7475:Stard9 UTSW 2 120,518,591 (GRCm39) missense probably damaging 1.00
R7523:Stard9 UTSW 2 120,530,078 (GRCm39) missense probably benign
R7553:Stard9 UTSW 2 120,524,289 (GRCm39) splice site probably null
R7624:Stard9 UTSW 2 120,518,627 (GRCm39) missense probably benign 0.15
R7761:Stard9 UTSW 2 120,529,860 (GRCm39) missense probably benign 0.00
R7794:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R7819:Stard9 UTSW 2 120,531,465 (GRCm39) missense probably damaging 1.00
R7823:Stard9 UTSW 2 120,532,587 (GRCm39) missense probably damaging 0.96
R7837:Stard9 UTSW 2 120,534,146 (GRCm39) missense probably benign 0.06
R7889:Stard9 UTSW 2 120,534,942 (GRCm39) missense probably benign 0.11
R7905:Stard9 UTSW 2 120,526,562 (GRCm39) missense not run
R7956:Stard9 UTSW 2 120,535,852 (GRCm39) nonsense probably null
R8013:Stard9 UTSW 2 120,518,582 (GRCm39) missense probably damaging 1.00
R8113:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8114:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8116:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R8117:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8118:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8170:Stard9 UTSW 2 120,530,529 (GRCm39) missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120,535,250 (GRCm39) missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120,532,270 (GRCm39) missense probably benign 0.00
R8337:Stard9 UTSW 2 120,510,306 (GRCm39) missense probably damaging 1.00
R8536:Stard9 UTSW 2 120,545,140 (GRCm39) missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120,533,796 (GRCm39) missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120,531,595 (GRCm39) missense probably benign 0.02
R8708:Stard9 UTSW 2 120,534,059 (GRCm39) missense probably damaging 1.00
R8732:Stard9 UTSW 2 120,510,442 (GRCm39) missense probably damaging 1.00
R8798:Stard9 UTSW 2 120,535,212 (GRCm39) missense probably benign 0.09
R8807:Stard9 UTSW 2 120,535,932 (GRCm39) missense probably damaging 1.00
R8807:Stard9 UTSW 2 120,535,943 (GRCm39) missense probably damaging 1.00
R8862:Stard9 UTSW 2 120,534,099 (GRCm39) missense probably benign
R8920:Stard9 UTSW 2 120,533,088 (GRCm39) missense probably damaging 0.96
R9026:Stard9 UTSW 2 120,536,283 (GRCm39) missense probably damaging 1.00
R9048:Stard9 UTSW 2 120,508,415 (GRCm39) missense probably damaging 0.99
R9049:Stard9 UTSW 2 120,510,418 (GRCm39) missense probably benign 0.30
R9152:Stard9 UTSW 2 120,529,068 (GRCm39) missense probably damaging 0.99
R9189:Stard9 UTSW 2 120,533,500 (GRCm39) missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120,528,447 (GRCm39) missense probably damaging 1.00
R9372:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R9393:Stard9 UTSW 2 120,518,656 (GRCm39) missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120,495,414 (GRCm39) missense probably damaging 1.00
R9514:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9515:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9516:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9570:Stard9 UTSW 2 120,534,714 (GRCm39) missense probably benign 0.02
R9649:Stard9 UTSW 2 120,526,635 (GRCm39) missense probably benign 0.20
R9789:Stard9 UTSW 2 120,510,417 (GRCm39) missense probably damaging 1.00
X0023:Stard9 UTSW 2 120,533,444 (GRCm39) missense possibly damaging 0.92
X0023:Stard9 UTSW 2 120,533,225 (GRCm39) missense probably benign 0.00
Z1176:Stard9 UTSW 2 120,528,803 (GRCm39) missense probably damaging 1.00
Z1176:Stard9 UTSW 2 120,527,093 (GRCm39) missense probably benign
Z1176:Stard9 UTSW 2 120,526,299 (GRCm39) missense probably benign 0.01
Z1177:Stard9 UTSW 2 120,504,157 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGCCCAATCCTGAAACTG -3'
(R):5'- CTTCGAGGTTCCTGATGACC -3'

Sequencing Primer
(F):5'- AGAGGACCACAGCATCATTTG -3'
(R):5'- ATCCTGCCAGGAGCATAA -3'
Posted On 2018-09-12