Incidental Mutation 'R6833:Pmfbp1'
ID534442
Institutional Source Beutler Lab
Gene Symbol Pmfbp1
Ensembl Gene ENSMUSG00000031727
Gene Namepolyamine modulated factor 1 binding protein 1
SynonymsF77, 1700016D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location109494027-109542640 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 109538675 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034162]
Predicted Effect probably null
Transcript: ENSMUST00000034162
SMART Domains Protein: ENSMUSP00000034162
Gene: ENSMUSG00000031727

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
internal_repeat_1 38 84 9.43e-6 PROSPERO
coiled coil region 89 121 N/A INTRINSIC
internal_repeat_1 138 178 9.43e-6 PROSPERO
coiled coil region 197 223 N/A INTRINSIC
coiled coil region 334 377 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
coiled coil region 411 732 N/A INTRINSIC
coiled coil region 758 879 N/A INTRINSIC
coiled coil region 931 968 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Pmfbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Pmfbp1 APN 8 109537993 missense possibly damaging 0.75
IGL01505:Pmfbp1 APN 8 109513911 missense probably damaging 1.00
IGL01609:Pmfbp1 APN 8 109527716 missense probably benign 0.12
IGL02066:Pmfbp1 APN 8 109541733 missense possibly damaging 0.76
IGL02926:Pmfbp1 APN 8 109520249 missense probably damaging 1.00
IGL03374:Pmfbp1 APN 8 109542414 utr 3 prime probably benign
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0046:Pmfbp1 UTSW 8 109535985 splice site probably benign
R0068:Pmfbp1 UTSW 8 109542379 splice site probably benign
R0211:Pmfbp1 UTSW 8 109541740 missense probably benign 0.03
R0244:Pmfbp1 UTSW 8 109541673 missense probably damaging 1.00
R0468:Pmfbp1 UTSW 8 109513968 splice site probably null
R0479:Pmfbp1 UTSW 8 109530473 splice site probably benign
R1124:Pmfbp1 UTSW 8 109530483 critical splice acceptor site probably null
R1332:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1336:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1621:Pmfbp1 UTSW 8 109499538 missense probably benign 0.04
R1961:Pmfbp1 UTSW 8 109530144 splice site probably benign
R2069:Pmfbp1 UTSW 8 109532103 missense possibly damaging 0.68
R2125:Pmfbp1 UTSW 8 109520273 missense probably damaging 1.00
R2889:Pmfbp1 UTSW 8 109525431 missense probably damaging 0.99
R3034:Pmfbp1 UTSW 8 109520921 critical splice acceptor site probably null
R3956:Pmfbp1 UTSW 8 109530169 missense probably benign 0.25
R4085:Pmfbp1 UTSW 8 109494947 missense possibly damaging 0.92
R4191:Pmfbp1 UTSW 8 109527628 missense probably benign 0.00
R4410:Pmfbp1 UTSW 8 109532063 missense probably benign 0.07
R4418:Pmfbp1 UTSW 8 109530633 missense probably benign 0.36
R4888:Pmfbp1 UTSW 8 109532160 missense probably damaging 1.00
R4937:Pmfbp1 UTSW 8 109535866 missense probably benign
R5070:Pmfbp1 UTSW 8 109530155 missense probably damaging 0.99
R5184:Pmfbp1 UTSW 8 109527767 missense possibly damaging 0.92
R5552:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
R5609:Pmfbp1 UTSW 8 109525107 missense probably damaging 1.00
R5760:Pmfbp1 UTSW 8 109521023 missense probably damaging 0.99
R5818:Pmfbp1 UTSW 8 109538679 splice site probably null
R6378:Pmfbp1 UTSW 8 109530266 missense probably damaging 0.99
R6496:Pmfbp1 UTSW 8 109532157 missense probably null 0.04
R6550:Pmfbp1 UTSW 8 109520207 missense possibly damaging 0.90
R6565:Pmfbp1 UTSW 8 109525428 nonsense probably null
R6624:Pmfbp1 UTSW 8 109530190 missense possibly damaging 0.92
R6684:Pmfbp1 UTSW 8 109535830 missense probably benign 0.10
R6823:Pmfbp1 UTSW 8 109530307 missense possibly damaging 0.92
R6940:Pmfbp1 UTSW 8 109525191 missense probably damaging 0.98
R7000:Pmfbp1 UTSW 8 109530589 missense possibly damaging 0.92
R7411:Pmfbp1 UTSW 8 109513871 missense probably damaging 1.00
R7563:Pmfbp1 UTSW 8 109525374 missense possibly damaging 0.83
R7782:Pmfbp1 UTSW 8 109527780 missense probably damaging 0.96
R8115:Pmfbp1 UTSW 8 109537037 missense probably damaging 1.00
R8712:Pmfbp1 UTSW 8 109538677 splice site probably benign
R8954:Pmfbp1 UTSW 8 109531801 missense probably benign 0.00
X0065:Pmfbp1 UTSW 8 109535867 missense probably benign 0.25
Z1088:Pmfbp1 UTSW 8 109513944 missense probably damaging 1.00
Z1176:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGACTGACAAGGCTCTCC -3'
(R):5'- AGGTCCCTTGTCAGTATAGTCAAG -3'

Sequencing Primer
(F):5'- GACTGACAAGGCTCTCCCTCTAG -3'
(R):5'- CAAGTGACATGTTAGTGTTGCAAAG -3'
Posted On2018-09-12