Incidental Mutation 'R6833:Zfp735'
ID534452
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73710608 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 126 (G126D)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect probably damaging
Transcript: ENSMUST00000080407
AA Change: G126D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: G126D

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GTATCAGTGGGTGATAGTTGAAAC -3'
(R):5'- AACTCGATTTAATGGTTGAGGGAG -3'

Sequencing Primer
(F):5'- AGTGATGCACTTCTGTGTTAATACAC -3'
(R):5'- ACTTAGTAAATGCTTCAGAGAAGTG -3'
Posted On2018-09-12