Incidental Mutation 'R6833:Tinf2'
ID534458
Institutional Source Beutler Lab
Gene Symbol Tinf2
Ensembl Gene ENSMUSG00000007589
Gene NameTerf1 (TRF1)-interacting nuclear factor 2
SynonymsD14Wsu146e, TIN2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55674689-55681820 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 55681580 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000154628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002397] [ENSMUST00000007733] [ENSMUST00000226314] [ENSMUST00000227842] [ENSMUST00000227873] [ENSMUST00000227914]
Predicted Effect probably benign
Transcript: ENSMUST00000002397
SMART Domains Protein: ENSMUSP00000002397
Gene: ENSMUSG00000002326

DomainStartEndE-ValueType
IMPDH 8 347 7.5e-147 SMART
Predicted Effect probably null
Transcript: ENSMUST00000007733
AA Change: M1K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007733
Gene: ENSMUSG00000007589
AA Change: M1K

DomainStartEndE-ValueType
Pfam:TINF2_N 20 159 1.8e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226314
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000226819
Predicted Effect probably null
Transcript: ENSMUST00000227842
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000227873
AA Change: M1K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227914
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins of the shelterin, or telosome, complex which protects telomeres by allowing the cell to distinguish between telomeres and regions of DNA damage. The protein encoded by this gene is a critical part of shelterin; it interacts with the three DNA-binding proteins of the shelterin complex, and it is important for assembly of the complex. Mutations in this gene cause dyskeratosis congenita (DKC), an inherited bone marrow failure syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality prior to E7.5 through a mechanism that is independent of telomerase function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Tinf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Tinf2 APN 14 55680464 splice site probably null
IGL01879:Tinf2 APN 14 55680906 unclassified probably benign
IGL03123:Tinf2 APN 14 55680889 missense probably damaging 0.99
R0815:Tinf2 UTSW 14 55680109 missense probably benign 0.01
R0863:Tinf2 UTSW 14 55680109 missense probably benign 0.01
R2862:Tinf2 UTSW 14 55680631 missense probably damaging 1.00
R5575:Tinf2 UTSW 14 55680174 missense probably benign 0.23
R7389:Tinf2 UTSW 14 55680710 splice site probably null
R8246:Tinf2 UTSW 14 55679585 missense probably damaging 0.97
R8368:Tinf2 UTSW 14 55679573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGATCTTAGTCCCAACC -3'
(R):5'- CACTTAAGTCACCGCCTGAGAG -3'

Sequencing Primer
(F):5'- TTTAGGCTCATACACAGGCG -3'
(R):5'- TCACCGCCTGAGAGGAGAC -3'
Posted On2018-09-12