Incidental Mutation 'R6833:Gm9195'
ID534460
Institutional Source Beutler Lab
Gene Symbol Gm9195
Ensembl Gene ENSMUSG00000109446
Gene Namepredicted gene 9195
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location72426013-72491838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72434416 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2586 (T2586A)
Ref Sequence ENSEMBL: ENSMUSP00000146536 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208955
AA Change: T2586A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Gm9195
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6448:Gm9195 UTSW 14 72434011 missense possibly damaging 0.81
R6617:Gm9195 UTSW 14 72431775 missense probably damaging 0.99
R6843:Gm9195 UTSW 14 72441211 missense possibly damaging 0.90
R6994:Gm9195 UTSW 14 72480831 missense probably damaging 1.00
R7082:Gm9195 UTSW 14 72442712 missense probably benign 0.41
R7157:Gm9195 UTSW 14 72480781 missense probably damaging 1.00
R7204:Gm9195 UTSW 14 72474186 missense probably damaging 1.00
R7208:Gm9195 UTSW 14 72451752 missense possibly damaging 0.93
R7319:Gm9195 UTSW 14 72460489 missense probably benign 0.03
R7368:Gm9195 UTSW 14 72480056 missense probably damaging 0.96
R7424:Gm9195 UTSW 14 72435777 missense possibly damaging 0.89
R7481:Gm9195 UTSW 14 72482676 missense probably benign 0.07
R7527:Gm9195 UTSW 14 72473870 missense possibly damaging 0.83
R7573:Gm9195 UTSW 14 72456682 missense probably null
R7618:Gm9195 UTSW 14 72452835 missense probably damaging 1.00
R7700:Gm9195 UTSW 14 72455902 splice site probably null
R7740:Gm9195 UTSW 14 72440673 missense possibly damaging 0.62
R7896:Gm9195 UTSW 14 72455738 missense unknown
R8005:Gm9195 UTSW 14 72426400 missense probably benign 0.07
R8124:Gm9195 UTSW 14 72442623 missense probably benign 0.41
R8177:Gm9195 UTSW 14 72460537 missense possibly damaging 0.49
R8353:Gm9195 UTSW 14 72440761 missense probably benign 0.41
R8371:Gm9195 UTSW 14 72460459 missense probably benign 0.07
R8453:Gm9195 UTSW 14 72440761 missense probably benign 0.41
R8700:Gm9195 UTSW 14 72482731 missense probably damaging 1.00
R8821:Gm9195 UTSW 14 72480096 missense possibly damaging 0.92
R8836:Gm9195 UTSW 14 72458390 missense probably benign 0.07
R8880:Gm9195 UTSW 14 72453880 missense unknown
Z1177:Gm9195 UTSW 14 72443002 missense possibly damaging 0.90
Z1177:Gm9195 UTSW 14 72453434 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGGTTTCACTTATCTCCACAG -3'
(R):5'- TGTGCTTAGCCCCACACAAG -3'

Sequencing Primer
(F):5'- GTTTTGCTCACACACAGGTACATG -3'
(R):5'- GCCCCACACAAGGCTAGG -3'
Posted On2018-09-12