Incidental Mutation 'R6833:Atf6b'
ID534464
Institutional Source Beutler Lab
Gene Symbol Atf6b
Ensembl Gene ENSMUSG00000015461
Gene Nameactivating transcription factor 6 beta
SynonymsCreb-rp, ATF6beta, Crebl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34647146-34655074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34649157 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000133516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]
Predicted Effect probably damaging
Transcript: ENSMUST00000015605
AA Change: S132P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173984
AA Change: S135P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Predicted Effect probably benign
Transcript: ENSMUST00000174796
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased cellular sensitivity to thapsigargin and tunicamycin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Atf6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Atf6b APN 17 34649137 missense probably damaging 0.99
IGL02010:Atf6b APN 17 34654652 missense probably benign 0.00
IGL02023:Atf6b APN 17 34651867 missense possibly damaging 0.93
IGL02141:Atf6b APN 17 34653277 missense probably benign 0.01
IGL02511:Atf6b APN 17 34654641 missense probably benign 0.01
IGL03347:Atf6b APN 17 34653240 missense probably damaging 1.00
R0112:Atf6b UTSW 17 34651626 missense probably damaging 0.97
R0285:Atf6b UTSW 17 34650396 unclassified probably benign
R0544:Atf6b UTSW 17 34648299 critical splice donor site probably null
R1618:Atf6b UTSW 17 34647728 nonsense probably null
R1689:Atf6b UTSW 17 34650302 missense probably damaging 0.98
R1823:Atf6b UTSW 17 34648644 missense possibly damaging 0.48
R1996:Atf6b UTSW 17 34652987 critical splice acceptor site probably null
R2057:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2058:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2059:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R4290:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4291:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4293:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4880:Atf6b UTSW 17 34654555 missense probably damaging 1.00
R4893:Atf6b UTSW 17 34648612 missense probably damaging 1.00
R5406:Atf6b UTSW 17 34653797 nonsense probably null
R5549:Atf6b UTSW 17 34651683 missense probably damaging 1.00
R5702:Atf6b UTSW 17 34651004 missense possibly damaging 0.93
R6386:Atf6b UTSW 17 34651851 missense probably damaging 0.97
R6834:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R7094:Atf6b UTSW 17 34653816 critical splice donor site probably null
R7205:Atf6b UTSW 17 34653729 missense probably damaging 1.00
R7261:Atf6b UTSW 17 34650818 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCGTGTCAGGACCACTTAGC -3'
(R):5'- GTCCTCGCTTTCAGTACTATTGT -3'

Sequencing Primer
(F):5'- TCAGGACCACTTAGCGCAGG -3'
(R):5'- CGCTTTCAGTACTATTGTTTCTATGG -3'
Posted On2018-09-12