Incidental Mutation 'R6834:Angptl1'
ID534478
Institutional Source Beutler Lab
Gene Symbol Angptl1
Ensembl Gene ENSMUSG00000033544
Gene Nameangiopoietin-like 1
SynonymsANGPT3, ANG-3, ANG3, 2810039D03Rik, ANGY, ARP1, ANG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156838562-156861078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156844693 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 30 (I30L)
Ref Sequence ENSEMBL: ENSMUSP00000107349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027885] [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000111720] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably benign
Transcript: ENSMUST00000027885
AA Change: I30L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027885
Gene: ENSMUSG00000033544
AA Change: I30L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FBG 274 489 1.3e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027886
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063199
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111720
AA Change: I30L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107349
Gene: ENSMUSG00000033544
AA Change: I30L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171292
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172057
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185198
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188656
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189316
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190648
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191605
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. The protein encoded by this gene is another member of the angiopoietin family that is widely expressed in adult tissues with mRNA levels highest in highly vascularized tissues. This protein was found to be a secretory protein that does not act as an endothelial cell mitogen in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no detectable phenotypic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Angptl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02835:Angptl1 UTSW 1 156858520 missense probably benign 0.22
R0285:Angptl1 UTSW 1 156845215 missense probably benign 0.00
R1237:Angptl1 UTSW 1 156858584 missense probably damaging 1.00
R1573:Angptl1 UTSW 1 156857170 missense possibly damaging 0.81
R1722:Angptl1 UTSW 1 156857085 missense possibly damaging 0.87
R4621:Angptl1 UTSW 1 156844924 missense probably damaging 1.00
R4795:Angptl1 UTSW 1 156860583 missense possibly damaging 0.88
R4849:Angptl1 UTSW 1 156857165 missense probably benign 0.01
R4915:Angptl1 UTSW 1 156844818 missense probably benign
R5919:Angptl1 UTSW 1 156858546 missense probably damaging 1.00
R6656:Angptl1 UTSW 1 156857236 missense probably damaging 1.00
R6833:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R7453:Angptl1 UTSW 1 156844851 missense probably benign 0.06
R7657:Angptl1 UTSW 1 156857220 missense probably benign 0.01
R7692:Angptl1 UTSW 1 156845315 missense probably damaging 1.00
RF002:Angptl1 UTSW 1 156857224 missense possibly damaging 0.79
X0066:Angptl1 UTSW 1 156844935 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTTTGTTGTTTATGGTTGAGGCAC -3'
(R):5'- TCCTTGAGGTTCTCCAGGTCC -3'

Sequencing Primer
(F):5'- CTGCCTGTGTAGAAAAGATGTCTCC -3'
(R):5'- AGGTCCATCCTGGTGATCATGTC -3'
Posted On2018-09-12