Mutagenetix > Incidental Mutations

Incidental Mutation 'R6834:Lrrc8a'

534483

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8a

Ensembl Gene

ENSMUSG00000007476

Gene Name

leucine rich repeat containing 8A

Synonyms

Lrrc8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6834 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30237715-30263790 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30255647 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 158 (S158T)

Ref Sequence

ENSEMBL: ENSMUSP00000139038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095078] [ENSMUST00000113654] [ENSMUST00000139454]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095078
AA Change: S158T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: S158T

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	340	1.4e-146	PFAM
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113654
AA Change: S158T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: S158T

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	3.3e-32	PFAM
Pfam:DUF3733	97	156	2e-22	PFAM
transmembrane domain	320	342	N/A	INTRINSIC
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000139454
AA Change: S158T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: S158T

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	3.3e-32	PFAM
Pfam:DUF3733	97	156	2e-22	PFAM
transmembrane domain	320	342	N/A	INTRINSIC
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,275,110	W530R	possibly damaging	Het
Aco1	A	G	4: 40,164,747	K79R	probably benign	Het
Adam15	C	T	3: 89,340,083	G426R	probably damaging	Het
Angptl1	A	T	1: 156,844,693	I30L	probably benign	Het
Ankrd35	A	G	3: 96,683,283	E295G	possibly damaging	Het
Ap5m1	T	A	14: 49,073,737	V88E	probably damaging	Het
Astn1	A	T	1: 158,664,122	Q47L	probably benign	Het
Atf6b	T	C	17: 34,649,157	S135P	probably damaging	Het
AU018091	T	A	7: 3,157,955	I589F	probably benign	Het
BC052040	T	C	2: 115,674,784	S179P	probably benign	Het
Cenpf	T	C	1: 189,659,446	K730E	probably damaging	Het
Chrna6	C	T	8: 27,408,310		probably null	Het
Dmxl1	A	T	18: 49,955,823	I2790F	probably damaging	Het
Ell	A	G	8: 70,579,134	D116G	probably damaging	Het
Eml5	A	T	12: 98,887,024	H105Q	probably damaging	Het
Epb41l2	T	A	10: 25,493,604	V23D	possibly damaging	Het
Gatad2b	T	A	3: 90,348,643	S139T	probably benign	Het
Glb1l	A	G	1: 75,201,753	V347A	possibly damaging	Het
Gm4846	A	T	1: 166,494,578	I140N	possibly damaging	Het
Gm7534	A	C	4: 134,193,165	V563G	possibly damaging	Het
Gm9268	G	C	7: 43,023,580	A143P	probably damaging	Het
Gng11	A	G	6: 4,008,068	I44V	probably benign	Het
H2-Ke6	T	C	17: 34,027,217	S161G	probably damaging	Het
Hsp90ab1	T	C	17: 45,570,467	I250V	probably benign	Het
Igkv4-79	A	G	6: 69,043,272	S20P	probably damaging	Het
Il11ra1	A	G	4: 41,765,454	H183R	probably benign	Het
Kcnip3	A	T	2: 127,458,358	F252I	probably damaging	Het
Klk11	T	C	7: 43,778,912	I242T	probably damaging	Het
Klk12	T	C	7: 43,773,348	V233A	possibly damaging	Het
Lama3	G	A	18: 12,491,548	C1450Y	probably damaging	Het
Lmod2	A	T	6: 24,597,783		probably benign	Het
Loxhd1	T	A	18: 77,441,526	V1089E	probably damaging	Het
Lrba	C	T	3: 86,350,286	P1286S	probably benign	Het
Lrrc41	T	C	4: 116,096,529	V804A	possibly damaging	Het
Mcm3	A	T	1: 20,810,096	M504K	possibly damaging	Het
Med24	A	T	11: 98,705,024		probably null	Het
Mrgprx1	T	C	7: 48,021,637	S121G	probably damaging	Het
Mvb12a	G	A	8: 71,545,252	M103I	probably benign	Het
Olfr726	A	G	14: 50,084,228	V151A	probably damaging	Het
Olfr730	T	C	14: 50,186,483	I245V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pacsin3	T	A	2: 91,262,835	M224K	probably damaging	Het
Pam	T	A	1: 97,837,992	I771F	probably damaging	Het
Pamr1	C	T	2: 102,614,931	R270C	probably damaging	Het
Pcdhgb8	G	T	18: 37,762,089	A71S	probably benign	Het
Poc1b	C	T	10: 99,192,804	A336V	probably benign	Het
Prss39	G	T	1: 34,498,616	V54F	possibly damaging	Het
Ptar1	A	G	19: 23,717,924	T252A	probably benign	Het
Ptprz1	A	G	6: 22,999,633	D574G	probably benign	Het
Rnf40	G	A	7: 127,596,406	D635N	probably benign	Het
Scn1a	T	A	2: 66,327,742	Q429L	probably damaging	Het
Sf1	G	T	19: 6,374,097	G386C	probably damaging	Het
Shank2	A	T	7: 144,409,894	Y623F	probably damaging	Het
Slc9a5	G	T	8: 105,364,684	A699S	probably benign	Het
Sox9	A	T	11: 112,784,000	Q208L	probably benign	Het
Synpo2l	A	T	14: 20,660,634	D865E	probably damaging	Het
Szt2	A	G	4: 118,388,325	S1097P	probably benign	Het
Tmc1	C	A	19: 20,795,610	E676*	probably null	Het
Ubr3	T	C	2: 70,000,481	I158T	possibly damaging	Het
Ush2a	T	C	1: 188,356,792	Y315H	probably damaging	Het
Vmn1r85	T	C	7: 13,084,644	D191G	probably damaging	Het
Zfp358	A	G	8: 3,495,613	D92G	probably benign	Het
Zfp735	G	A	11: 73,710,608	G126D	probably damaging	Het

Other mutations in Lrrc8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Lrrc8a	APN	2	30255315	missense	probably benign	0.32
IGL01161:Lrrc8a	APN	2	30255810	missense	probably damaging	1.00
IGL01419:Lrrc8a	APN	2	30257099	missense	probably benign	0.09
IGL01757:Lrrc8a	APN	2	30255525	missense	possibly damaging	0.81
IGL02390:Lrrc8a	APN	2	30256701	missense	probably damaging	1.00
IGL02608:Lrrc8a	APN	2	30256299	missense	possibly damaging	0.91
IGL02938:Lrrc8a	APN	2	30255686	missense	probably damaging	1.00
IGL02960:Lrrc8a	APN	2	30257013	missense	probably damaging	1.00
IGL03139:Lrrc8a	APN	2	30255671	missense	probably damaging	1.00
IGL03166:Lrrc8a	APN	2	30255365	missense	probably benign
R0033:Lrrc8a	UTSW	2	30255345	missense	probably damaging	1.00
R0033:Lrrc8a	UTSW	2	30255345	missense	probably damaging	1.00
R0276:Lrrc8a	UTSW	2	30256788	missense	possibly damaging	0.54
R0432:Lrrc8a	UTSW	2	30257067	missense	probably damaging	1.00
R0751:Lrrc8a	UTSW	2	30256350	missense	possibly damaging	0.82
R1924:Lrrc8a	UTSW	2	30255250	missense	probably damaging	1.00
R2029:Lrrc8a	UTSW	2	30256649	missense	probably damaging	1.00
R3852:Lrrc8a	UTSW	2	30261960	missense	probably benign	0.30
R4898:Lrrc8a	UTSW	2	30257202	missense	probably benign	0.00
R5175:Lrrc8a	UTSW	2	30255512	missense	probably damaging	1.00
R5616:Lrrc8a	UTSW	2	30255354	missense	probably benign	0.09
R5874:Lrrc8a	UTSW	2	30257136	missense	probably damaging	1.00
R6228:Lrrc8a	UTSW	2	30256553	missense	possibly damaging	0.82
R6406:Lrrc8a	UTSW	2	30257091	missense	possibly damaging	0.56
R6456:Lrrc8a	UTSW	2	30255474	missense	probably benign	0.14
R6833:Lrrc8a	UTSW	2	30255647	missense	possibly damaging	0.92
R6945:Lrrc8a	UTSW	2	30256227	missense	probably damaging	1.00
R7675:Lrrc8a	UTSW	2	30255668	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCTAGATCGACACCAGTAC -3'
(R):5'- TTCTCAAACAGGGCCTTCGC -3'

Sequencing Primer
(F):5'- CCAGTACAACTACGTGGATGCG -3'
(R):5'- AATCCGTGACTTGGTCCGCTG -3'

Posted On

2018-09-12