Incidental Mutation 'R6834:Aco1'
ID534494
Institutional Source Beutler Lab
Gene Symbol Aco1
Ensembl Gene ENSMUSG00000028405
Gene Nameaconitase 1
SynonymsIrp1, Irebp, Aco-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location40143081-40198338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40164747 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 79 (K79R)
Ref Sequence ENSEMBL: ENSMUSP00000100038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102973]
Predicted Effect probably benign
Transcript: ENSMUST00000102973
AA Change: K79R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100038
Gene: ENSMUSG00000028405
AA Change: K79R

DomainStartEndE-ValueType
Pfam:Aconitase 54 564 4.5e-180 PFAM
Pfam:Aconitase_C 692 821 1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aconitase/IPM isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Depending on iron levels in the cytosol, the encoded protein can function as either an aconitase enzyme or as an mRNA binding protein. When cellular iron levels are high, the encoded protein functions as an aconitase, an essential enzyme in the TCA cycle that catalyzes the conversion of citrate to isocitrate. When cellular iron levels are low, the encoded protein regulates iron uptake and utilization by binding to iron-responsive elements in the untranslated regions of mRNAs for genes involved in iron metabolism. Disruption of this gene is associated with pulmonary hypertension and polycythemia. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Aco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Aco1 APN 4 40180290 critical splice donor site probably null
IGL01081:Aco1 APN 4 40197576 missense probably benign
IGL01364:Aco1 APN 4 40181380 splice site probably null
IGL01733:Aco1 APN 4 40175738 splice site probably benign
IGL02232:Aco1 APN 4 40175996 missense probably damaging 1.00
IGL02709:Aco1 APN 4 40180199 missense possibly damaging 0.86
IGL03164:Aco1 APN 4 40167116 missense probably benign 0.30
IGL03208:Aco1 APN 4 40186424 missense possibly damaging 0.55
IGL03324:Aco1 APN 4 40186363 missense probably benign
IGL03353:Aco1 APN 4 40175893 missense probably damaging 0.99
R0002:Aco1 UTSW 4 40176649 splice site probably benign
R0486:Aco1 UTSW 4 40177783 missense probably damaging 1.00
R0636:Aco1 UTSW 4 40175697 missense probably damaging 1.00
R1344:Aco1 UTSW 4 40179008 missense probably damaging 1.00
R1844:Aco1 UTSW 4 40197566 missense probably benign 0.00
R1889:Aco1 UTSW 4 40164607 critical splice acceptor site probably null
R1932:Aco1 UTSW 4 40176499 missense probably damaging 1.00
R1959:Aco1 UTSW 4 40167193 critical splice donor site probably null
R1965:Aco1 UTSW 4 40175730 missense probably damaging 1.00
R1983:Aco1 UTSW 4 40175845 missense probably benign 0.37
R2072:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2073:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2074:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R3155:Aco1 UTSW 4 40182915 missense probably damaging 1.00
R4595:Aco1 UTSW 4 40167139 missense probably benign 0.43
R4999:Aco1 UTSW 4 40176507 missense probably damaging 1.00
R5131:Aco1 UTSW 4 40163797 missense probably benign
R5354:Aco1 UTSW 4 40180290 critical splice donor site probably null
R5380:Aco1 UTSW 4 40177848 missense probably damaging 1.00
R6352:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6353:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6380:Aco1 UTSW 4 40185028 missense probably benign 0.02
R6540:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6751:Aco1 UTSW 4 40188330 intron probably null
R6760:Aco1 UTSW 4 40180210 nonsense probably null
R6833:Aco1 UTSW 4 40164747 missense probably benign 0.00
R7019:Aco1 UTSW 4 40186376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTGAAAAGCAGGTGCCC -3'
(R):5'- TCCTGGTTTCTCAGAGACAAAGC -3'

Sequencing Primer
(F):5'- CCCTGTGGTTTGAGGTTATTAATGC -3'
(R):5'- GCTACAGTAAAAACTTTCTTGGGAGG -3'
Posted On2018-09-12