Incidental Mutation 'R6834:Gm9268'
ID534505
Institutional Source Beutler Lab
Gene Symbol Gm9268
Ensembl Gene ENSMUSG00000091528
Gene Namepredicted gene 9268
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43018798-43048106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 43023580 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 143 (A143P)
Ref Sequence ENSEMBL: ENSMUSP00000129068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166914] [ENSMUST00000173815]
Predicted Effect probably damaging
Transcript: ENSMUST00000166914
AA Change: A143P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129068
Gene: ENSMUSG00000091528
AA Change: A143P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 473 1.1e-41 PFAM
Pfam:NCD3G 516 569 1.7e-23 PFAM
Pfam:7tm_3 602 837 9.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173815
AA Change: A136P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134441
Gene: ENSMUSG00000091528
AA Change: A136P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 5.3e-40 PFAM
Pfam:NCD3G 509 562 4.6e-22 PFAM
Pfam:7tm_3 594 831 1.1e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Gm9268
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Gm9268 APN 7 43024709 missense probably damaging 0.97
IGL01753:Gm9268 APN 7 43024715 missense probably damaging 1.00
IGL02338:Gm9268 APN 7 43047736 missense probably damaging 1.00
IGL02541:Gm9268 APN 7 43023668 splice site probably benign
R0751:Gm9268 UTSW 7 43047409 missense probably damaging 0.99
R0849:Gm9268 UTSW 7 43024718 missense probably damaging 1.00
R1460:Gm9268 UTSW 7 43023215 missense probably benign 0.25
R1617:Gm9268 UTSW 7 43024079 missense probably benign 0.18
R1962:Gm9268 UTSW 7 43047400 missense probably benign 0.00
R1999:Gm9268 UTSW 7 43047459 missense probably damaging 1.00
R2022:Gm9268 UTSW 7 43024030 missense probably benign
R2434:Gm9268 UTSW 7 43047457 missense probably damaging 0.99
R3760:Gm9268 UTSW 7 43024078 missense probably benign 0.00
R4562:Gm9268 UTSW 7 43023562 nonsense probably null
R4890:Gm9268 UTSW 7 43047600 missense probably damaging 1.00
R5221:Gm9268 UTSW 7 43023260 missense probably benign 0.31
R5597:Gm9268 UTSW 7 43024649 missense probably benign 0.01
R6589:Gm9268 UTSW 7 43023598 missense possibly damaging 0.91
R6831:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6910:Gm9268 UTSW 7 43024051 missense probably benign 0.01
R6944:Gm9268 UTSW 7 43047969 missense possibly damaging 0.95
R7470:Gm9268 UTSW 7 43047886 missense probably damaging 1.00
R7553:Gm9268 UTSW 7 43048023 missense probably damaging 1.00
R7661:Gm9268 UTSW 7 43023158 missense probably benign 0.00
R7677:Gm9268 UTSW 7 43024739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAACTCTTGGATTTGAGCATC -3'
(R):5'- TGGATCTGTCATCAAGTACCTTC -3'

Sequencing Primer
(F):5'- AGGTCAGGAGTTCAAGTCCC -3'
(R):5'- TCAAGTACCTTCATCATTTACTTTGG -3'
Posted On2018-09-12