Incidental Mutation 'R6834:Med24'
ID534521
Institutional Source Beutler Lab
Gene Symbol Med24
Ensembl Gene ENSMUSG00000017210
Gene Namemediator complex subunit 24
SynonymsTrap100, 100kDa, Thrap4, Pparb2, R75526, DRIP100, Gse2, D11Ertd307e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98704591-98729435 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 98705024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000017354] [ENSMUST00000017354] [ENSMUST00000038886] [ENSMUST00000100500] [ENSMUST00000100500] [ENSMUST00000100500] [ENSMUST00000138750]
Predicted Effect probably null
Transcript: ENSMUST00000017354
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000017354
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000017354
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038886
SMART Domains Protein: ENSMUSP00000037762
Gene: ENSMUSG00000038067

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 54 N/A INTRINSIC
IL6 57 205 3.59e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100500
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100500
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100500
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene may form a submodule of the mediator complex that magnifies the effects of activators on the general transcription machinery. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die prior to birth exhibiting abnormal heart development, neural tube defects, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Med24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Med24 APN 11 98709682 missense probably damaging 0.99
IGL01960:Med24 APN 11 98707542 missense probably benign
IGL02119:Med24 APN 11 98728835 missense probably benign 0.14
IGL02681:Med24 APN 11 98709739 nonsense probably null
IGL03038:Med24 APN 11 98716184 missense possibly damaging 0.93
IGL03377:Med24 APN 11 98705136 missense possibly damaging 0.67
R1186:Med24 UTSW 11 98717757 utr 3 prime probably benign
R1887:Med24 UTSW 11 98718816 critical splice donor site probably benign
R1888:Med24 UTSW 11 98707282 utr 3 prime probably benign
R1936:Med24 UTSW 11 98718816 critical splice donor site probably null
R2063:Med24 UTSW 11 98715646 missense probably damaging 0.98
R3895:Med24 UTSW 11 98706388 missense probably benign
R4328:Med24 UTSW 11 98707116 critical splice donor site probably null
R4751:Med24 UTSW 11 98706432 missense probably damaging 0.98
R5195:Med24 UTSW 11 98710281 missense possibly damaging 0.71
R5237:Med24 UTSW 11 98710783 missense probably damaging 0.98
R6047:Med24 UTSW 11 98707765 nonsense probably null
R6984:Med24 UTSW 11 98718542 missense possibly damaging 0.51
R7015:Med24 UTSW 11 98718852 missense possibly damaging 0.51
R7244:Med24 UTSW 11 98714397 splice site probably null
R7479:Med24 UTSW 11 98704961 missense possibly damaging 0.52
R7536:Med24 UTSW 11 98712621 missense possibly damaging 0.52
R7594:Med24 UTSW 11 98715097 missense probably damaging 0.98
R7667:Med24 UTSW 11 98713164 missense possibly damaging 0.71
R7745:Med24 UTSW 11 98704967 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTGTAGGGCCATGATGAGTC -3'
(R):5'- CCCAGTTTGTGCAGTGGTTC -3'

Sequencing Primer
(F):5'- TGGGAAGGTCTCACTCTCCTG -3'
(R):5'- GCAGTGGTTCATGGAGGAG -3'
Posted On2018-09-12