Incidental Mutation 'R6836:Tpr'
ID534542
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6836 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 150436673 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably null
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124973
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151563
SMART Domains Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 79 235 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 368 384 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 588 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7961:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R8013:Tpr UTSW 1 150398608 missense probably benign
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATGTGCGCTTGATGTAGC -3'
(R):5'- TTCAGCTTCTTCGGGAGAGG -3'

Sequencing Primer
(F):5'- ACCCCCAGATATTTTGGGCTG -3'
(R):5'- GAGAGGCATTTCCACTGTGTCC -3'
Posted On2018-09-12