Incidental Mutation 'R6836:Aim2'
List |< first << previous [record 78 of 1826] next >> last >|
ID534544
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Nameabsent in melanoma 2
SynonymsLOC383619, Ifi210
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R6836 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173350879-173466040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 173463980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 317 (T317R)
Ref Sequence ENSEMBL: ENSMUSP00000119465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000160565] [ENSMUST00000166137] [ENSMUST00000173023]
PDB Structure
Structure of murine DNA binding protein bound with ds DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000147604
AA Change: T317R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: T317R

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160565
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000166137
AA Change: T317R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: T317R

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 C113R probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L236P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1857* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173455465 missense probably benign 0.23
IGL01086:Aim2 APN 1 173455433 missense probably damaging 0.99
IGL02292:Aim2 APN 1 173462274 missense probably benign 0.05
IGL02382:Aim2 APN 1 173459749 unclassified probably null
R0226:Aim2 UTSW 1 173462333 splice site probably benign
R0609:Aim2 UTSW 1 173461964 missense probably damaging 0.98
R1281:Aim2 UTSW 1 173459811 nonsense probably null
R2054:Aim2 UTSW 1 173463982 missense probably damaging 1.00
R2110:Aim2 UTSW 1 173459713 missense probably benign 0.00
R4080:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4081:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4082:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4452:Aim2 UTSW 1 173455444 missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173455524 critical splice donor site silent
R4731:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173459806 missense probably benign 0.04
R5009:Aim2 UTSW 1 173455366 missense probably damaging 0.96
R6290:Aim2 UTSW 1 173462115 missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173455236 intron probably null
R6821:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6838:Aim2 UTSW 1 173463980 missense probably damaging 1.00
X0021:Aim2 UTSW 1 173463919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCTAGCTTGTCTGATAACTG -3'
(R):5'- TGAATGACAGGCTTCTCAGGTC -3'

Sequencing Primer
(F):5'- GTCTGATAACTGATTGATATGCTGC -3'
(R):5'- TCTCAGGTCTGTGAGATGCAAAG -3'
Posted OnSep 12, 2018