Mutagenetix > Incidental Mutations

Incidental Mutation 'R6836:Adamtsl2'

534545

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6836 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to C at 27081706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1 (M1T)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably null
Transcript: ENSMUST00000091233
AA Change: M1T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: M1T

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,196,504	I81F	possibly damaging	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Alox8	T	C	11: 69,186,505	Y473C	probably damaging	Het
Alox8	T	C	11: 69,189,889	R209G	possibly damaging	Het
Asb5	A	G	8: 54,585,071	M210V	probably benign	Het
Atp2c2	T	A	8: 119,734,415	L249Q	probably damaging	Het
AU018091	T	G	7: 3,164,156	D77A	probably damaging	Het
Bahcc1	A	T	11: 120,271,757	K294*	probably null	Het
Baz2b	C	T	2: 59,917,425	R1298Q	probably damaging	Het
Bivm	T	A	1: 44,143,136	N501K	possibly damaging	Het
Bpifb5	T	A	2: 154,228,065	I145N	probably benign	Het
Casq2	A	T	3: 102,086,760	N41I	probably damaging	Het
Ccdc18	T	C	5: 108,197,967	L993P	probably damaging	Het
Cfap44	A	G	16: 44,404,079	D50G	probably damaging	Het
Clca3a2	T	A	3: 144,806,383	I91F	probably damaging	Het
Crebbp	T	A	16: 4,180,022	H66L	possibly damaging	Het
Cyfip2	T	C	11: 46,272,640	T321A	probably benign	Het
Dido1	A	G	2: 180,662,307	V1268A	probably benign	Het
E030030I06Rik	A	C	10: 22,148,492	V174G	probably damaging	Het
Gm20730	G	T	6: 43,081,833		probably null	Het
Gm36176	T	C	10: 77,847,142		probably benign	Het
Gper1	T	A	5: 139,426,680	M260K	probably damaging	Het
Igfbp2	T	C	1: 72,849,658	L89P	probably damaging	Het
Katnal1	T	C	5: 148,894,164	N200S	probably damaging	Het
Kcnk13	G	T	12: 100,061,689	R341L	probably damaging	Het
Klhl20	T	A	1: 161,105,406	E277D	probably benign	Het
Lingo1	T	C	9: 56,619,772	Y517C	probably damaging	Het
Lrrk1	C	T	7: 66,342,779	E82K	probably benign	Het
Mtor	T	A	4: 148,489,498	V1275D	possibly damaging	Het
Ncan	C	T	8: 70,100,315	S1089N	possibly damaging	Het
Notch4	C	T	17: 34,586,100	T1643I	probably damaging	Het
Olfr1258	T	C	2: 89,930,339	C177R	probably damaging	Het
Olfr1357	A	G	10: 78,612,590	L17P	probably damaging	Het
Olfr1387	A	T	11: 49,460,077	T133S	possibly damaging	Het
Olfr539	A	C	7: 140,668,180	I298L	possibly damaging	Het
Pcdhgb6	T	C	18: 37,742,962	V241A	probably benign	Het
Phf11b	T	A	14: 59,328,123	T102S	possibly damaging	Het
Pkd1	T	A	17: 24,581,259	V2998E	probably damaging	Het
Ppp1r13b	T	C	12: 111,835,195	S352G	probably benign	Het
Ptprh	C	T	7: 4,551,135	V778M	probably damaging	Het
Ptprz1	C	T	6: 23,030,665	Q1008*	probably null	Het
Ralgapa1	A	T	12: 55,604,273		probably null	Het
Rbm20	G	A	19: 53,814,069	G336E	probably damaging	Het
Sdsl	T	C	5: 120,462,102	I77V	probably benign	Het
Serpina3b	G	A	12: 104,134,082	E308K	probably benign	Het
Sfrp5	G	A	19: 42,201,710	T101I	probably damaging	Het
Slc2a13	C	T	15: 91,321,632	V451I	probably benign	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Spg11	C	T	2: 122,059,535	A2109T	probably damaging	Het
Stard9	C	T	2: 120,699,843	R2194C	probably benign	Het
Tfeb	T	C	17: 47,786,198		probably null	Het
Tiam2	T	A	17: 3,414,380	I128N	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tpr	T	G	1: 150,436,673		probably null	Het
Traf3ip1	T	C	1: 91,521,000	I456T	probably benign	Het
Ttll4	T	A	1: 74,689,413	D892E	probably damaging	Het
Ubr1	T	A	2: 120,896,675		probably null	Het
Vmn2r74	T	A	7: 85,957,422	I239F	probably benign	Het
Wdfy3	C	T	5: 101,952,999	V251M	probably damaging	Het
Xylb	T	A	9: 119,391,754	L531H	probably damaging	Het
Zfp960	T	A	17: 17,088,172	C383S	probably damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGCTCAGACTTGGCATTCAC -3'
(R):5'- GCTCAACACCTAGCTGAGAAG -3'

Sequencing Primer
(F):5'- GGGCAGACATCTGTAATTACTTACC -3'
(R):5'- ATACTACTCACGGAAGCC -3'

Posted On

2018-09-12