Mutagenetix > Incidental Mutation

Incidental Mutation 'R6836:Bpifb5'

534551

Institutional Source

Beutler Lab

Gene Symbol

Bpifb5

Ensembl Gene

ENSMUSG00000038572

Gene Name

BPI fold containing family B, member 5

Synonyms

BC018465

Accession Numbers

Genbank: NM_144890; MGI: 2385160

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6836 (G1)

Quality Score

214.009

Status

Validated

Chromosome

Chromosomal Location

154223742-154240902 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 154228065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 145 (I145N)

Ref Sequence

ENSEMBL: ENSMUSP00000046683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045959]

AlphaFold

Q3UQ05

Predicted Effect

probably benign
Transcript: ENSMUST00000045959
AA Change: I145N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000046683
Gene: ENSMUSG00000038572
AA Change: I145N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
coiled coil region	26	54	N/A	INTRINSIC
Pfam:LBP_BPI_CETP	94	231	7.6e-14	PFAM
Blast:BPI2	291	488	4e-91	BLAST
SCOP:d1ewfa2	433	486	8e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (62/62)

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,196,504	I81F	possibly damaging	Het
Adamtsl2	T	C	2: 27,081,706	M1T	probably null	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Alox8	T	C	11: 69,186,505	Y473C	probably damaging	Het
Alox8	T	C	11: 69,189,889	R209G	possibly damaging	Het
Asb5	A	G	8: 54,585,071	M210V	probably benign	Het
Atp2c2	T	A	8: 119,734,415	L249Q	probably damaging	Het
AU018091	T	G	7: 3,164,156	D77A	probably damaging	Het
Bahcc1	A	T	11: 120,271,757	K294*	probably null	Het
Baz2b	C	T	2: 59,917,425	R1298Q	probably damaging	Het
Bivm	T	A	1: 44,143,136	N501K	possibly damaging	Het
Casq2	A	T	3: 102,086,760	N41I	probably damaging	Het
Ccdc18	T	C	5: 108,197,967	L993P	probably damaging	Het
Cfap44	A	G	16: 44,404,079	D50G	probably damaging	Het
Clca3a2	T	A	3: 144,806,383	I91F	probably damaging	Het
Crebbp	T	A	16: 4,180,022	H66L	possibly damaging	Het
Cyfip2	T	C	11: 46,272,640	T321A	probably benign	Het
Dido1	A	G	2: 180,662,307	V1268A	probably benign	Het
E030030I06Rik	A	C	10: 22,148,492	V174G	probably damaging	Het
Gm20730	G	T	6: 43,081,833		probably null	Het
Gm36176	T	C	10: 77,847,142		probably benign	Het
Gper1	T	A	5: 139,426,680	M260K	probably damaging	Het
Igfbp2	T	C	1: 72,849,658	L89P	probably damaging	Het
Katnal1	T	C	5: 148,894,164	N200S	probably damaging	Het
Kcnk13	G	T	12: 100,061,689	R341L	probably damaging	Het
Klhl20	T	A	1: 161,105,406	E277D	probably benign	Het
Lingo1	T	C	9: 56,619,772	Y517C	probably damaging	Het
Lrrk1	C	T	7: 66,342,779	E82K	probably benign	Het
Mtor	T	A	4: 148,489,498	V1275D	possibly damaging	Het
Ncan	C	T	8: 70,100,315	S1089N	possibly damaging	Het
Notch4	C	T	17: 34,586,100	T1643I	probably damaging	Het
Olfr1258	T	C	2: 89,930,339	C177R	probably damaging	Het
Olfr1357	A	G	10: 78,612,590	L17P	probably damaging	Het
Olfr1387	A	T	11: 49,460,077	T133S	possibly damaging	Het
Olfr539	A	C	7: 140,668,180	I298L	possibly damaging	Het
Pcdhgb6	T	C	18: 37,742,962	V241A	probably benign	Het
Phf11b	T	A	14: 59,328,123	T102S	possibly damaging	Het
Pkd1	T	A	17: 24,581,259	V2998E	probably damaging	Het
Ppp1r13b	T	C	12: 111,835,195	S352G	probably benign	Het
Ptprh	C	T	7: 4,551,135	V778M	probably damaging	Het
Ptprz1	C	T	6: 23,030,665	Q1008*	probably null	Het
Ralgapa1	A	T	12: 55,604,273		probably null	Het
Rbm20	G	A	19: 53,814,069	G336E	probably damaging	Het
Sdsl	T	C	5: 120,462,102	I77V	probably benign	Het
Serpina3b	G	A	12: 104,134,082	E308K	probably benign	Het
Sfrp5	G	A	19: 42,201,710	T101I	probably damaging	Het
Slc2a13	C	T	15: 91,321,632	V451I	probably benign	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Spg11	C	T	2: 122,059,535	A2109T	probably damaging	Het
Stard9	C	T	2: 120,699,843	R2194C	probably benign	Het
Tfeb	T	C	17: 47,786,198		probably null	Het
Tiam2	T	A	17: 3,414,380	I128N	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tpr	T	G	1: 150,436,673		probably null	Het
Traf3ip1	T	C	1: 91,521,000	I456T	probably benign	Het
Ttll4	T	A	1: 74,689,413	D892E	probably damaging	Het
Ubr1	T	A	2: 120,896,675		probably null	Het
Vmn2r74	T	A	7: 85,957,422	I239F	probably benign	Het
Wdfy3	C	T	5: 101,952,999	V251M	probably damaging	Het
Xylb	T	A	9: 119,391,754	L531H	probably damaging	Het
Zfp960	T	A	17: 17,088,172	C383S	probably damaging	Het

Other mutations in Bpifb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01543:Bpifb5	APN	2	154233249	missense	possibly damaging	0.86
IGL01676:Bpifb5	APN	2	154229049	missense	possibly damaging	0.71
IGL02065:Bpifb5	APN	2	154227183	missense	probably damaging	0.98
IGL02141:Bpifb5	APN	2	154229557	splice site	probably null
IGL02244:Bpifb5	APN	2	154225148	missense	possibly damaging	0.93
IGL03118:Bpifb5	APN	2	154236753	splice site	probably benign
A4554:Bpifb5	UTSW	2	154227180	missense	possibly damaging	0.71
R0022:Bpifb5	UTSW	2	154230348	missense	probably damaging	0.98
R0492:Bpifb5	UTSW	2	154228900	missense	probably benign	0.11
R0654:Bpifb5	UTSW	2	154228900	missense	probably benign	0.11
R0692:Bpifb5	UTSW	2	154234696	missense	probably benign	0.33
R0707:Bpifb5	UTSW	2	154228900	missense	probably benign	0.11
R0898:Bpifb5	UTSW	2	154233334	missense	probably benign
R1534:Bpifb5	UTSW	2	154229499	missense	possibly damaging	0.86
R1539:Bpifb5	UTSW	2	154223856	missense	probably benign
R1874:Bpifb5	UTSW	2	154227202	splice site	probably benign
R1971:Bpifb5	UTSW	2	154230344	missense	probably benign	0.18
R2001:Bpifb5	UTSW	2	154233279	missense	possibly damaging	0.53
R3013:Bpifb5	UTSW	2	154228855	missense	possibly damaging	0.59
R3916:Bpifb5	UTSW	2	154228181	missense	probably benign
R4499:Bpifb5	UTSW	2	154240758	missense	possibly damaging	0.53
R5250:Bpifb5	UTSW	2	154224961	missense	probably benign
R6301:Bpifb5	UTSW	2	154230219	missense	possibly damaging	0.73
R6869:Bpifb5	UTSW	2	154233223	missense	probably benign	0.33
R7014:Bpifb5	UTSW	2	154224956	nonsense	probably null
R7300:Bpifb5	UTSW	2	154228146	missense	possibly damaging	0.85
R7427:Bpifb5	UTSW	2	154225122	missense	probably benign
R7428:Bpifb5	UTSW	2	154225122	missense	probably benign
R7439:Bpifb5	UTSW	2	154228933	missense	possibly damaging	0.71
R7448:Bpifb5	UTSW	2	154230185	missense	possibly damaging	0.53
R7935:Bpifb5	UTSW	2	154229055	missense	probably benign	0.01
R8964:Bpifb5	UTSW	2	154230278	missense	possibly damaging	0.96
R9049:Bpifb5	UTSW	2	154228176	missense	probably benign	0.00
R9058:Bpifb5	UTSW	2	154238897	missense	possibly damaging	0.85
R9349:Bpifb5	UTSW	2	154225085	missense	possibly damaging	0.96
T0975:Bpifb5	UTSW	2	154229464	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACACTCAGTGCAGGTGTCTG -3'
(R):5'- TTTGAAGGAGAGGCAGCCCTAG -3'

Sequencing Primer
(F):5'- CTGCTGCCCTTGTGAGGATC -3'
(R):5'- CCACTGCAGAAAGGGCTG -3'

Posted On

2018-09-12