Incidental Mutation 'R6836:Slc6a9'
ID534555
Institutional Source Beutler Lab
Gene Symbol Slc6a9
Ensembl Gene ENSMUSG00000028542
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 9
SynonymsGlyt1, Glyt-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6836 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117834506-117875198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117867886 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 559 (A559V)
Ref Sequence ENSEMBL: ENSMUSP00000127289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000132043] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000169885] [ENSMUST00000169990] [ENSMUST00000171052]
Predicted Effect probably benign
Transcript: ENSMUST00000030269
AA Change: A555V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542
AA Change: A555V

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
AA Change: A555V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542
AA Change: A555V

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect probably benign
Transcript: ENSMUST00000132043
SMART Domains Protein: ENSMUSP00000122676
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 32 321 1.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163288
AA Change: A559V

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542
AA Change: A559V

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169885
AA Change: A443V

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542
AA Change: A443V

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169990
SMART Domains Protein: ENSMUSP00000127203
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 84 373 2.3e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Meta Mutation Damage Score 0.2221 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid glycine acts as an inhibitory neurotransmitter in the central nervous system. The protein encoded by this gene is one of two transporters that stop glycine signaling by removing it from the synaptic cleft. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice die shortly after birth exhibiting breathing and movement deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Slc6a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Slc6a9 APN 4 117864617 missense probably damaging 1.00
IGL01728:Slc6a9 APN 4 117864605 missense probably damaging 1.00
IGL02111:Slc6a9 APN 4 117864013 missense probably benign 0.19
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R1170:Slc6a9 UTSW 4 117864806 missense possibly damaging 0.77
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R3499:Slc6a9 UTSW 4 117856803 missense probably benign 0.01
R4744:Slc6a9 UTSW 4 117867895 missense probably benign 0.00
R4970:Slc6a9 UTSW 4 117856008 missense probably damaging 1.00
R5055:Slc6a9 UTSW 4 117868150 unclassified probably null
R5103:Slc6a9 UTSW 4 117868155 missense probably benign
R5726:Slc6a9 UTSW 4 117864013 missense probably damaging 1.00
R7030:Slc6a9 UTSW 4 117857436 missense possibly damaging 0.94
R7061:Slc6a9 UTSW 4 117868064 missense probably benign 0.40
R7278:Slc6a9 UTSW 4 117868106 missense probably benign 0.31
R7863:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R7946:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R8036:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
Z1176:Slc6a9 UTSW 4 117857366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTGACAGTTGCCTATGCCC -3'
(R):5'- TTTCAAACGCTGCAGGCAG -3'

Sequencing Primer
(F):5'- CACCTTTTGCTGACCTAGGAGGAG -3'
(R):5'- GGGGGCGCAGTGAAAAGC -3'
Posted On2018-09-12