Mutagenetix > Incidental Mutation

Incidental Mutation 'R6836:Gper1'

534560

Institutional Source

Beutler Lab

Gene Symbol

Gper1

Ensembl Gene

ENSMUSG00000053647

Gene Name

G protein-coupled estrogen receptor 1

Synonyms

FEG-1, Gpr30, Ceprl, 6330420K13Rik, Gper, GPCR-Br, CMKRL2

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.283) question?

Stock #

R6836 (G1)

Quality Score

89.0077

Status

Validated

Chromosome

Chromosomal Location

139423151-139427800 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139426680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 260 (M260K)

Ref Sequence

ENSEMBL: ENSMUSP00000080370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066052] [ENSMUST00000066211] [ENSMUST00000198474]

AlphaFold

Q8BMP4

Predicted Effect

probably benign
Transcript: ENSMUST00000066052

SMART Domains

Protein: ENSMUSP00000069230
Gene: ENSMUSG00000053553

Domain	Start	End	E-Value	Type
low complexity region	54	77	N/A	INTRINSIC
Pfam:DUF2373	103	165	3e-26	PFAM
low complexity region	184	194	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066211
AA Change: M260K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080370
Gene: ENSMUSG00000053647
AA Change: M260K

Domain	Start	End	E-Value	Type
Pfam:7tm_1	76	324	2e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198474

SMART Domains

Protein: ENSMUSP00000142949
Gene: ENSMUSG00000053553

Domain	Start	End	E-Value	Type
low complexity region	54	77	N/A	INTRINSIC
Pfam:DUF2373	102	141	9e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum. The protein binds estrogen, resulting in intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. Alternate transcriptional splice variants which encode the same protein have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased thymic atrophy, insulin, and glucagon responses following treatment with PGE2. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,196,504	I81F	possibly damaging	Het
Adamtsl2	T	C	2: 27,081,706	M1T	probably null	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Alox8	T	C	11: 69,186,505	Y473C	probably damaging	Het
Alox8	T	C	11: 69,189,889	R209G	possibly damaging	Het
Asb5	A	G	8: 54,585,071	M210V	probably benign	Het
Atp2c2	T	A	8: 119,734,415	L249Q	probably damaging	Het
AU018091	T	G	7: 3,164,156	D77A	probably damaging	Het
Bahcc1	A	T	11: 120,271,757	K294*	probably null	Het
Baz2b	C	T	2: 59,917,425	R1298Q	probably damaging	Het
Bivm	T	A	1: 44,143,136	N501K	possibly damaging	Het
Bpifb5	T	A	2: 154,228,065	I145N	probably benign	Het
Casq2	A	T	3: 102,086,760	N41I	probably damaging	Het
Ccdc18	T	C	5: 108,197,967	L993P	probably damaging	Het
Cfap44	A	G	16: 44,404,079	D50G	probably damaging	Het
Clca3a2	T	A	3: 144,806,383	I91F	probably damaging	Het
Crebbp	T	A	16: 4,180,022	H66L	possibly damaging	Het
Cyfip2	T	C	11: 46,272,640	T321A	probably benign	Het
Dido1	A	G	2: 180,662,307	V1268A	probably benign	Het
E030030I06Rik	A	C	10: 22,148,492	V174G	probably damaging	Het
Gm20730	G	T	6: 43,081,833		probably null	Het
Gm36176	T	C	10: 77,847,142		probably benign	Het
Igfbp2	T	C	1: 72,849,658	L89P	probably damaging	Het
Katnal1	T	C	5: 148,894,164	N200S	probably damaging	Het
Kcnk13	G	T	12: 100,061,689	R341L	probably damaging	Het
Klhl20	T	A	1: 161,105,406	E277D	probably benign	Het
Lingo1	T	C	9: 56,619,772	Y517C	probably damaging	Het
Lrrk1	C	T	7: 66,342,779	E82K	probably benign	Het
Mtor	T	A	4: 148,489,498	V1275D	possibly damaging	Het
Ncan	C	T	8: 70,100,315	S1089N	possibly damaging	Het
Notch4	C	T	17: 34,586,100	T1643I	probably damaging	Het
Olfr1258	T	C	2: 89,930,339	C177R	probably damaging	Het
Olfr1357	A	G	10: 78,612,590	L17P	probably damaging	Het
Olfr1387	A	T	11: 49,460,077	T133S	possibly damaging	Het
Olfr539	A	C	7: 140,668,180	I298L	possibly damaging	Het
Pcdhgb6	T	C	18: 37,742,962	V241A	probably benign	Het
Phf11b	T	A	14: 59,328,123	T102S	possibly damaging	Het
Pkd1	T	A	17: 24,581,259	V2998E	probably damaging	Het
Ppp1r13b	T	C	12: 111,835,195	S352G	probably benign	Het
Ptprh	C	T	7: 4,551,135	V778M	probably damaging	Het
Ptprz1	C	T	6: 23,030,665	Q1008*	probably null	Het
Ralgapa1	A	T	12: 55,604,273		probably null	Het
Rbm20	G	A	19: 53,814,069	G336E	probably damaging	Het
Sdsl	T	C	5: 120,462,102	I77V	probably benign	Het
Serpina3b	G	A	12: 104,134,082	E308K	probably benign	Het
Sfrp5	G	A	19: 42,201,710	T101I	probably damaging	Het
Slc2a13	C	T	15: 91,321,632	V451I	probably benign	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Spg11	C	T	2: 122,059,535	A2109T	probably damaging	Het
Stard9	C	T	2: 120,699,843	R2194C	probably benign	Het
Tfeb	T	C	17: 47,786,198		probably null	Het
Tiam2	T	A	17: 3,414,380	I128N	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tpr	T	G	1: 150,436,673		probably null	Het
Traf3ip1	T	C	1: 91,521,000	I456T	probably benign	Het
Ttll4	T	A	1: 74,689,413	D892E	probably damaging	Het
Ubr1	T	A	2: 120,896,675		probably null	Het
Vmn2r74	T	A	7: 85,957,422	I239F	probably benign	Het
Wdfy3	C	T	5: 101,952,999	V251M	probably damaging	Het
Xylb	T	A	9: 119,391,754	L531H	probably damaging	Het
Zfp960	T	A	17: 17,088,172	C383S	probably damaging	Het

Other mutations in Gper1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
P0040:Gper1	UTSW	5	139426488	missense	probably benign	0.00
R1233:Gper1	UTSW	5	139426602	missense	probably damaging	1.00
R1785:Gper1	UTSW	5	139426722	missense	probably damaging	1.00
R1786:Gper1	UTSW	5	139426722	missense	probably damaging	1.00
R2078:Gper1	UTSW	5	139426133	missense	probably benign	0.30
R3827:Gper1	UTSW	5	139427000	missense	probably benign	0.10
R4604:Gper1	UTSW	5	139426725	missense	probably damaging	0.98
R4914:Gper1	UTSW	5	139426868	missense	probably benign	0.35
R5171:Gper1	UTSW	5	139426658	missense	probably damaging	1.00
R7801:Gper1	UTSW	5	139426688	missense	probably benign	0.25
R8302:Gper1	UTSW	5	139426275	missense	probably benign	0.41
R8708:Gper1	UTSW	5	139425935	missense	probably benign
R9142:Gper1	UTSW	5	139426557	missense	possibly damaging	0.82
R9354:Gper1	UTSW	5	139426274	missense	possibly damaging	0.61
R9511:Gper1	UTSW	5	139426383	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCATCTGGATGGCCTCAGTG -3'
(R):5'- TCAGGCAGCTGTTGGAGAAG -3'

Sequencing Primer
(F):5'- TTCACAGCGGTGCACCTG -3'
(R):5'- AGGCTGCAAGGTTGACTATG -3'

Posted On

2018-09-12